Monday, August 20, 2012

The Trouble With the Information Age: The Information Is Mostly Crap

The trouble with having access to a limitless quantity of books, newspapers, magazines, television, the alternative media, and the statements of educators is that we rarely have means of knowing what of this so-called information is true.

In the distant past, when ignorance was near universal, what people knew, they knew from the facts of often hard experience. They knew that steam scolds, frost freezes, that there is no free lunch except by theft and that civil authority rests on brute force: all of which small stock of information was incontrovertibly true.

Today, by contrast, our knowledge is not only incomparably greater, it is mostly bunk. We believe, for example, that 19 more or less clueless Muslims with paper knives beat NORAD, the World's most expensive air defense system, and that, quite reasonably, no one was fired for NORAD's failure. We know that's true because all the media say so, because no book from a reputable publisher argues otherwise, and because any scholar who argues otherwise is promptly ousted from the groves of academe.

In addition, we believe that because some 19th Century bond trader named David Ricardo pointed out the rather obvious fact that, in international trade, countries benefit by specializing in what they do best, it is therefore an excellent idea for capitalists and bankers to take the capital accumulated in the West through the sweat of generations and invest it, along with the best of Western technology, in the Third World where wages are only three to 10% of those in the West, thereby robbing workers in the West of their livelihood, while enriching said captalists and bankers. This notwithstanding that David Ricardo explicitly stated that capital exports would negate the benefit of international trade to the country exporting capital.

Then, as the US builds out a totalitarian police state fronted by lightweight democratic puppets such as Dubya the torture president and Obama the Assassin, the "information"-rich American public express their confidence in the modern incarnation of the Gestapo.

Some, skeptical of the so-called mainstream media, look to the Internet and the alternative media for "true facts" about the world. But we know that Obama's modern incarnation of the Committee of Public Information has been set to work under the direction of erstwhile "Information Tzar," Cass Sunstein, to infiltrate the alt. media and destroy whatever integrity they may otherwise have had.

Even books, or perhaps one should say especially books, are now a source of very questionable "information." Matt Ridley's "The Rational Optimist" (rated a "Best Book of the Year" by the Economist Magazine) comes to mind. Ridley, which is to say, the 5th Viscount Ridley, FRSL, FMedSci, DL, Eton, Oxford, author of TED.com talk "when ideas have sex" viewed 1.4 million times, author of award winning books, great grandson of architect Sir Eward Lutyens, nephew of a tory cabinet minister, etc., etc.)  would seems to be a well-educated chap and someone you might reasonably expect to tell you something worth knowing. But you'd be wrong.

Ridley's books is riddled with crass errors or outright lies.

Taking Adam Smith's now universally accepted insight that prosperity depends on the division and specialization of labor, Ridley offers seemingly superfluous support for the concept through examination of the way in which small populations are unable to achieve a high division and specialization of labor and thus suffer from poverty. An example he takes is that of the now extinct Tasmanians who, few in number and confined to an island, gradually lost many of the skills possessed by their ancestors who populated Tasmania before the land bridge to the Australian subcontinent disappeared many thousands of years ago.

Then he says, "In contrast to Tasmania, Tierra del Fuego -- an island not much bigger than Tasmania, home to not many more people and generally rather colder and less hospitable, -- possessed a race of who, when Charles Dawin met them in 1834, set bait for fish, nets for seals, ... used hooks and harpoons .... and clothing. [the difference between the two populations being] that the Fuegians were in fairly frequent contact with other people across the straight of Magellan so they could relearn lost skills..."

This must seem an odd claim to anyone who has actually read Darwin's account of his visit to Tierra del Fuego:
While going one day on shore near Wollaston Island, we pulled alongside a canoe with six Fuegians. These were the most abject and miserable creatures I anywhere beheld. On the east coast the natives, as we have seen, have guanaco cloaks, and on the west they possess seal-skins. Amongst these central tribes the men generally have an otter-skin, or some small scrap about as large as a pocket-handkerchief, which is barely sufficient to cover their backs as low down as their loins. It is laced across the breast by strings, and according as the wind blows, it is shifted from side to side. But these Fuegians in the canoe were quite naked, and even one full-grown woman was absolutely so. It was raining heavily, and the fresh water, together with the spray, trickled down her body. In another harbour not far distant, a woman, who was suckling a recently-born child, came one day alongside the vessel, and remained there out of mere curiosity, whilst the sleet fell and thawed on her naked bosom, and on the skin of her naked baby! These poor wretches were stunted in their growth, their hideous faces bedaubed with white paint, their skins filthy and greasy, their hair entangled, their voices discordant, and their gestures violent.... At night, five or six human beings, naked and scarcely protected from the wind and rain of this tempestuous climate, sleep on the wet ground coiled up like animals. Whenever it is low water, winter or summer, night or day, they must rise to pick shellfish from the rocks; and the women either dive to collect sea-eggs, or sit patiently in their canoes, and with a baited hair-line without any hook, jerk out little fish. If a seal is killed, or the floating carcass of a putrid whale is discovered, it is a feast; and such miserable food is assisted by a few tasteless berries and fungi. ...
Hardly convincing evidence, one would have thought, for the contention that the Fuegians were more prosperous than the Tasmanians or anyone else by virtue of their cultural connection with the larger mainland community. 

But if one ludicrous misrepresentation of Charles Darwin by a graduate in Zoology with first class honors from the University of Oxford does not a Lord Haw Haw of the New World Order make, what is one to make of the Right Honorable Lord Ridley's energetic rebuttal of those who say that "'Wal-Mart is the world's largest sweatshop' for paying low wages even though Wal-Mart pays twice the minimum wage..."

Ha! There you are, Wal-Mart is not evil. On the contrary, they provide thousands and thousands of Americans with darned good jobs. And if you doubt that you'll find his Lordship's book has lots more about Sam Walton's prosperity-generating Wal-Mart stores, which according to Ridley provide "enormous benefits that (especially the poorest) customers reap in terms of cheaper more varied and better goods." 

But Ridley has nothing whatever to say about Wal-Mart forcing suppliers to offshore production destroying good jobs for Wal-Mart's "poorest customers" in the process. And as for the claim about Wal-Mart paying twice the minimum wage, that seems as inaccurate as his Lordship's recollection of Darwin's account of the life of the Fuegians. And in fact, Lord Matty would have us believe that Wal-Mart employees, like the Fuegians, really have a jolly high standard of life.

Yet, as Henry Blodgett writes in the Business Insider,
Walmart pays its average "associate," of which it has about 1.5 million in the U.S., just under $12 an hour. This equates to an annual salary that is below the poverty line.
Moreover, employee comments reveal Wal-Mart to be a company heartily loathed by many of its employees who consider it to be both exploitive and abusive. And Wal-Mart does not hesitate, apparently, to cheat workers outright. But then how else would the Walton family's wealth have come to exceed that of the poorest 120 million Americans.

And so the book goes: everything is for the best in this the best possible of all capitalist worlds. Corporations are not evil. It is to the corporations we owe our liberty. Corporations are weak and vulnerable, yet they have brought prosperity and freedom, ended slavery, cruelty, child abuse and oppression. I'm not making this up, but I cannot quote the whole insane book.

And the beauty of capitalism, says Ridley, is that no one is in charge. Everything works to achieve greater and greater happiness for all through the working of the collective intelligence.That 146 corporations, including banks such as Barclays, Deutsche Bank, Goldman Sachs and JP Morgan control almost half of all international business activity, or that these corporations largely finance our so-called democratic election campaigns and the think tanks such as the Council on Foreign Relations that advise governments, is not something Matt Ridley would have you worry about. He refrains even from mentioning such potentially worrying facts. But then Ridley was himself a banker: specifically, the Chair of Northern Rock during the years leading to its bankruptcy that cost the British taxpayer billions.

Friday, August 17, 2012

The mis-selling of higher education

By Fraser Nelson

The Telegraph, August 16, 2012: To listen to ministers talk about university education, it is as if Britain has entered an academic arms race with the rest of the world. China’s universities, we’re told, are spewing out six million graduates a year: we must compete, or we’re doomed. In the Blair years, a national target was set: half of all young people ought to enter higher education. They’d have to get into debt, but they were reassured it would be a worthwhile investment. Having some letters after your name meant going further in your careers and earning far more. Those without a degree, by implication, would enter the workplace at a distinct disadvantage.

It is surprising that David Willetts should continue this line of argument, because he is clever enough to know what simplistic nonsense it is. It is understandable for the Universities Minister to be in favour of studying, but the real picture of education in Britain is far more complex. The idea of a binary divide in the career prospects of graduates and non-graduates is not a picture that would be recognised by employers. In many lines of work, those who did not get the A-levels for university now have a future just as bright (or otherwise) as the graduates.

From the moment that John Major started to abolish student grants, the British government has been in the business of selling (rather than simply providing) higher education. Yes, studying costs, runs the argument, but it is an investment: what students pay is a small fraction of what they will get back.
Then came the proliferation of courses and institutions, from BA (Hons) in Golf Management at the University of the Highlands and Islands to Trade Union Studies at Blackpool College. The definition of a degree has changed massively, but the financial argument used for getting one has not changed at all.

When Mr Willetts trebled the cap on university fees, he justified this by arguing that a university degree will “on average boost your earnings by £100,000 over a lifetime”. If true, that would – more or less – justify the average £40,000 of debt which is expected to face those who start college this autumn. But it doesn’t take a A* in A-level maths to suspect that the £100,000 figure disguises a vast range of alternative scenarios, many of which imply disadvantage for those who, for whatever reason, give university a miss.

Last year the Government released a research paper that spelt it out. For doctors and dentists, a degree is a prerequisite. They will earn £400,000 more over a lifetime, as you might expect, having been fully trained for a well-paid profession. But for students admitted to less rigorous degrees, the premium quickly diminishes – especially for men. Those who graduate in the subjects I studied, history and philosophy, can expect to earn a paltry £35 a year more than non-graduates. For graduates in “mass communication” the premium is just £120 a year. But both are better value than a degree in “creative arts”, where graduates can actually expect to earn £15,000 less, over a lifetime, than those who start work aged 18.

Read more

Monday, August 13, 2012

People Liberals Love to Hate, No. 29: Nationalists


Everyone loves to hate, even a liberal.

Believing that hate itself to be morally repugnant, a liberal can hate only those whose beliefs are morally repugnant.

Fortunately, that is not a problem, since to a liberal, whatever is not liberal is, by definition, morally repugnant.

Among those whom the liberal most loves to hate is the nationalist, for a nationalist is, to a liberal,self-evidently a racist, and a racist is for all practical purposes a white supremacist, and a white supremacist is in effect a Nazi, and a Nazi is the most hateful creature that ever walked this earth.

Thus it is that a liberal can view a nationalist with the orgasmic hatred of a Nazi contemplating a Jew.

Remarkably, this puts the the Zionist Jew, the Prime Minister of England, the Deputy Prime Minister of England and all the other openly avowed gentile supporters of Israel in the same camp as the Nazis, since all are advocates of what is perhaps the world's most virulent nationalism.

Also in the Nazi camp, according to the liberal view of nationalism, are Canada's 600 plus first nations who strive to perpetuate their national identity and racial heritage, revive their cultural tradition, and regain control of their ancestral lands.

Which suggests that there is something genocidal, hateful even, about the liberal view of nationalism.

Sunday, August 12, 2012

Obama Ignores Judge and Law in Asserting Tyrannical Power

What makes our NDAA lawsuit a struggle to save the US constitution

By Tangerine Bolen

Tangerine Bolen
Activist and reporter Tangerine Bolen, a plaintiff in the case against the NDAA, speaking to the media after a New York judge enjoined section 2012 of the law. Photograph via Fromthetrenchesworldreport
The Guardian, August 10, 2012: I am one of the lead plaintiffs in the civil lawsuit against the National Defense Authorization Act, which gives the president the power to hold any US citizen anywhere for as long as he wants, without charge or trial.

In a May hearing, Judge Katherine Forrest issued an injunction against it; this week, in a final hearing in New York City, US government lawyers asserted even more extreme powers – the right to disregard entirely the judge and the law. On Monday 6 August, Obama's lawyers filed an appeal to the injunction – a profoundly important development that, as of this writing, has been scarcely reported.

In the earlier March hearing, US government lawyers had confirmed that, yes, the NDAA does give the president the power to lock up people like journalist Chris Hedges and peaceful activists like myself and other plaintiffs. Government attorneys stated on record that even war correspondents could be locked up indefinitely under the NDAA.

Judge Forrest had ruled for a temporary injunction against an unconstitutional provision in this law, after government attorneys refused to provide assurances to the court that plaintiffs and others would not be indefinitely detained for engaging in first amendment activities. At that time, twice the government has refused to define what it means to be an "associated force", and it claimed the right to refrain from offering any clear definition of this term, or clear boundaries of power under this law.
This past week's hearing was even more terrifying. Government attorneys again, in this hearing, presented no evidence to support their position and brought forth no witnesses. Most incredibly, Obama's attorneys refused to assure the court, when questioned, that the NDAA's section 1021 – the provision that permits reporters and others who have not committed crimes to be detained without trial – has not been applied by the US government anywhere in the world after Judge Forrest's injunction. In other words, they were telling a US federal judge that they could not, or would not, state whether Obama's government had complied with the legal injunction that she had laid down before them.
To this, Judge Forrest responded that if the provision had indeed been applied, the United States government would be in contempt of court.

Friday, August 10, 2012

Lawsuit: US Department of Homeland Security Run by Perverts. Who'd Have Thought It

New York Daily News, August 9, 2012: Looks like the Department of Homeland Security could be renamed the Department of Hyper Sexuality.

A blistering federal discrimination suit accuses agency honcho Janet Napolitano of turning the department into a female-run “frat house” where male staffers were banished to the bathrooms and routinely humiliated.

James Hayes Jr., who now is New York’s top Homeland Security cop, claims Napolitano filled top spots in Washington, D.C., with two of her gal pals who were bent on tormenting male employees.

The suit identified them as Dora Schriro, who is now running the city Department of Correction, and Suzanne Barr, the chief of staff for the U.S. Immigration and Customs Enforcement.

Soon after Schriro and Barr were hired in January 2009, male staffers were treated like lapdogs, Hayes claims.

Barr “moved the entire contents of the offices of three employees, including name plates, computers and telephones, to the men’s bathroom at ICE headquarters,” the suit says.

Barr also stole a male staffer’s BlackBerry and fired off a message to his female supervisor indicating that he “had a crush on [her] and fantasized about her,” Hayes claims.

Sometimes, Barr took a more direct approach. In one case, she called a male colleague in his hotel room and screamed at him using sexually humiliating language, the suit says.

Hayes claims that after he reported the abuse to the Equal Employment Opportunity office, Napolitano launched a series of misconduct investigations against him.

Hayes claims he was denied a prized promotion and systematically pushed aside while working out of ICE’s Washington office. The suit says Schriro was named the special adviser to Secretary Napolitano on Detention and Removal Operations and began to replace Hayes at meetings despite having no “experience in managing a federal law enforcement department.”

Schriro did, however, have a “long standing relationship with [Napolitano],” the suit says.

Hayes, who is seeking relief for $335,000 in damages, was named the special agent in charge of ICE’s New York field office in Oct. 2009.

ICE Director of Public Affairs Brian Hale blasted the suit, which was filed in May and first reported by the blog, debbieschlussel.com.

“ICE doesn’t comment on unfounded claims and will respond to Mr. Hayes’ allegations as appropriate through the judicial system,” he said.

A Department of Correction spokesman denied claims that her relationship with Napolitano figured into her hiring.

“Commissioner Schriro’s selection and service at DHS was based on the merits. Any suggestion to the contrary is false,” spokesman Robin Campbell said.

Wednesday, August 8, 2012

The Chinese: A lot like Americans used to be

A123 Goes Chinese 

By Bob Lutz

Forbes Magazine, August 8, 2012: A Chinese auto parts company, Wanxiang, has come to the rescue of cash-strapped A123 Systems, an American high-tech lithium-ion battery maker and centerpiece of the Obama administration’s “green jobs” revolution. Wanxiang can acquire up to an 80% of the company in return for an investment of up to $450 million.

The recipient of a $249 million “green technology” grant from our federal government, A123, believing their own (and everyone else’s) hype about the millions of electric vehicles that would soon be filling the nation’s highways (it will happen, but not soon) set about proving an old adage: stupidity and waste increase with the amount of money available. Production capacity was set at a level that was way overly optimistic, and the headquarters complex, with its magnificent office suites and marbled lobbies, was something only a company with tons of money would dream of. But I’m sure the risk seemed low: After all, the “green revolution” was upon us. Even Nancy Pelosi said it was so!
But, as always in this vexing, over-regulated, over-taxed but still-twitching private enterprise system of ours, the marketplace overwhelmingly voted for the speed, range and lower price of conventional cars, even at $4 per gallon. It’s another example of a government-directed “green jobs” initiative which, while environmentally praiseworthy (especially if you believe in manmade global warming), was economically idiotic: when capital is spent on a product for which there is insufficient demand, negative economic value is created and jobs, green or otherwise, are lost. To make matters worse, not only is the capital lost, but, had it not been squandered on green “hope and change,” that same capital could have been spent productively, creating something that the public actually wants and needs.

That’s the real crime of the “green jobs” initiative: it destroys capital that is so badly needed elsewhere to revitalize our economy.

Read more

The intolerance of liberals. No. 79

Olympic Political Correctness
Who will win the racial-sensitivity gold medal?
By John Fund

Greek triple-jump champion Voula Papachristou

National Review Online, August 7, 2012: The London Olympics features 302 events. But this year there clearly is a new category: racial sensitivity. These Olympic Games are rife with examples of people taking offense, and it’s time to discuss some guardrails and guidelines before political correctness takes over completely.

First, some behavior on the part of athletes is clearly out of bounds. After Swiss footballer Michel Morganella’s team lost to South Korea, he said on Twitter that his opponents could “go burn” and were a “bunch of mongoloids.” That’s hardly sporting behavior, and he was sent home for insulting the dignity of the Korean team. Beyond that, it was just offensive speech.

And sometimes it’s the critics who are clearly out of line. NBC was deluged with criticism because it ran an ad that offended fans of gold-medal-winning U.S. gymnast Gabby Douglas, who is black. NBC commentator Bob Costas had just finished a commentary in which he said that “much of America has fallen in love with Gabby Douglas” when a gymnastics-themed commercial appeared promoting NBC’s comedy Animal Practice. It featured a small, grinning monkey doing gymnastic tricks.

Because African Americans have sometimes been compared to simians by people trying to dehumanize them, many viewers complained the ad was racist. NBC responded with an apology and an explanation that the ad was placed in the lineup of commercials long before Douglas won her medal. That should end that story.

Saturday, August 4, 2012

How Canada Opted for Libertarian Socialism

By William Gairdner

williamgairdner.com, March 28, 2012: 

This is an excerpt from Chapter One of The Trouble With Canada ... Still! (BPS Books, 2011)

        As it happened, in his very person Trudeau embodied the French and English styles described above, for he had a French-Canadian father, and a Scottish mother. Canadian scholars burn a lot of energy debating whether Trudeau was a “socialist” or a “libertarian” and assume the two things are contradictory. For he famously said that “the state has no place in the bedrooms of the nation.” But he also entrenched coast-to-coast radical equalization policies in his Charter. Here was a man very comfortable with multiple mistresses, with legislating homosexual rights, and who, even as Prime Minister did not mind taking off his clothes and sunbathing nude in mixed company.[1] He was a flamboyant libertarian who imposed the most controlling and expensive Statist regime on Canada in its history.

         So was he a socialist or a libertarian?

         My answer:  he was a “libertarian socialist,” and we Canadians all now live under his libertarian socialists regime. But how? How can this circle be squared? These things are opposites, aren’t they? Not really. It’s just the two labels are applied to different things. Think of what is individual, private, and physical: your body. Then think of what is public and general: a service like health care, or education, or a language right. Trudeau’s Charter combined and enabled these two conflicting styles by encouraging the separation of the private body, from the public body.  He was a libertarian in that he believed matters of the private body are no one else’s business. But when it came to goods he felt we all deserve from the State? Why, then a powerful system for providing, equalizing, and controlling access to such goods must be set up, and this would be done through taxation and fiscal bribery of the provinces; that is, through shared-cost programs or grants financed by exorbitant levels of individual taxation and unconscionable borrowing.  But what kind of socialism was it? What kind of libertarianism?   
    
His Socialist Conviction

             Trudeau was trying, as mentioned, to spin the wheel slowly, so that without realizing the change of direction, a Canadian would find himself “disembarking at a different island than the one he thought he was sailing for.” Fundamentally, on the public level, all that he did was clearly and resolutely substitute the French-Statist style for the English-Liberty style at every opportunity. By the time he was finished, Canada had changed from a fiscally stable, low-debt, reasonably free, only mildly-socialized nation under limited government, to one bending under huge public debt, highly managerial, and much more thoroughly socialist in its fiscal and social commitments. In his first and only major book, Federalism and the French Canadians, Trudeau clearly outlined this plan for Canada. At the time, most leftists argued that socialism could not successfully be planted in a nation such as ours with an existing federal system because the powers of governance in such nations are already divided as between central and local jurisdictions, and this division of powers is entrenched forever in their constitutions. So the general conclusion was that Canada was not and never would be a candidate for socialism. But Trudeau disagreed. He spoke admiringly of "that superb strategist, Mao Tse-Tung" who argued that “planting socialism” in various regional strongholds was "the very best thing." Accordingly, Trudeau developed the argument that systems such as Canada’s, contrary to the advice of all the theorists, can indeed be made socialist, and that our British-style federal system "must be welcomed as a valuable tool which permits dynamic parties to plant socialist governments in certain provinces, from which the seeds of radicalism can slowly spread"[2]

 His Libertarian Conviction

                 Trudeau probably wrote as much about individual rights as about socialism, and most scholars, and the public in general continue to believe these two political philosophies are in clear contradiction. Certainly, in their party platforms, socialists and libertarians are sworn enemies. But as mentioned, Trudeau’s genius was to combine these contraries by splitting their domains between what is inside our skin, and what is outside it: private body, and public body; person and polis.  

        He was throwing the Canadian people a bone by reducing the larger realm of freedom to which they had been accustomed, to their persons and bodies. But all the “public” freedoms having to do with economics and trade, private property, education, provision of health care, welfare, and so on, would fall under Statist regulation. He knew that if he could leave us unfettered and free with respect to most of our personal bodily pleasures, we would be fooled into believing we were still free in all our former ways. But those were precisely the freedoms he despised: the bottom-up political, economic, and legislative realities essential to the creation of the British-style that produced what he called scornfully, our "checkerboard federalism." To him, Canada’s parliamentarians were “just nobodies,” and “a crummy lot” (this, he uttered publicly in 1969).  The British Style was a reality that stood in the way of his French-style plan for Statism. So the system had to be changed. Trudeau was Canada’s Procrustes, doing his utmost to make a one-size-fits-all political bed for Canadian citizens.  

          His libertarian ethic, which is based on the idea that liberty means doing whatever you want as long as you don’t harm anyone else, was absorbed from typical English individualist thinking that was radicalized by John Stuart Mill in his canonical booklet, On Liberty (1859). It is called Mill’s “Harm Principle,” and it neatly articulated Mill’s simplistic argument for the privatization of morality that it has by now become the standard reasoning in defence of personal moral autonomy all over the Western world. Prior to Mill, throughout our long Judeo-Christian tradition, morality – codes of right and wrong behavior - had always been considered a community good. Moral standards reflected common religious and community standards. The metaphor was that we all live under a common moral bubble wherein by means of conviction, belief, and debate we sustain a common set of shalls and shall-nots that defines us morally … who we are.  Mill argued instead that we each ought to live under our own private self-defined moral bubble, and be concerned for others only if we bump into them. Then we just apologize, or negotiate a solution to any harm done.

         Mill failed to see that if you are completely alone in the universe it is true that you can do whatever you want, and call it “morality” if you like. But because there are no other human beings in existence and you cannot therefore help or harm anyone else, you can also call it Winnie-the-Pooh. However, as soon as someone else exists in addition to yourself, you must take into consideration whether your actions will help them, or harm them, now, or in the future, directly or indirectly. Suddenly, what was a personal and private act, becomes public, and thus falls under the term “morality,” rightly considered. In his person and in his politics, Trudeau combined two conflicting styles: the personal libertarianism articulated by Mill, and the Statism of Rousseau.

The intolerance of liberals

By Chris Kempling Psy.D., R.C.C.

Narth.com: The raging public debate over same sex marriages in Canada, and now Massachusetts, has highlighted the great divide between those who are socially liberal, and those who are socially conservative.

Generally speaking, the socially liberal are found on the center-left of the political spectrum, and include labor unions, women's and gay rights organizations, human-rights tribunals, much of the popular media, a good proportion of the "intelligentsia"," and, it may be argued, the judiciary.

Social conservatives tend to occupy the political right, and may be found in large numbers among those who adhere to organized religions, and many immigrant cultural groups. The socially liberal appear to be in the ascendancy and have been remarkably successful in achieving many of their goals to "modernize" culture and society. Social conservatives decry such "progress," seeing instead a degradation of moral behavior and standards of social conduct.

A very thoughtful analysis of why this great divide exists is contained in an article entitled "Sexual Morality: The cultures and emotions of conservatives and liberals," published in the Journal of Applied Social Psychology (Haidt and Hersh, 2001). Haidt and Hersh argue that, in the area of sexual conduct, social liberals operate within a narrow moral framework which they call the "ethics of autonomy" (EOA). The ethics of autonomy hold that only acts that cause harm to self or others should be condemned. Acts which are consensual and are perceived not to cause harm should be tolerated or even affirmed.

Under EOA, rationalization for approval of various non-traditional sexual behaviors is justified under the concept of the right of individuals to behave autonomously, acting according to their own conscience, rather than a higher authority.

It can be argued that EOA is foundational to the arguments social liberals make for re-defining what types of sexual behaviors and relationships are acceptable in today's society. Thus, when people say that there is nothing wrong with allowing homosexuals to marry, or that homosexuality should be taught as a normal variant in public school sex education classes, or that adult-child sex is not really harmful and should be permitted, they are using the ethics of autonomy as the philosophical base for their position. The EOA recently prevailed in the US when the Supreme Court struck down the anti-sodomy laws of Texas. Pierre Trudeau's decision in 1968 to remove homosexual acts from the criminal code, because "the state has no business in the bedrooms of the nations," was also an EOA-based decision.

Social conservatives operate on a much broader moral plain. Haidt and Hersh posit that social conservatives base their attitudes of what is morally acceptable on two additional sets of ethics: the ethics of community (EOC) and the ethics of divinity (EOD). The ethics of community are concerned with duty, perceived social roles, traditions, mutual respect, and what is appropriate for maintaining social order and family life. EOC is found in such organizations as Focus on the Family, REAL Women and the Canadian Alliance for Social Justice and Family Values. The latter organization is almost entirely made up of Chinese Canadians. Middle Eastern and South Asian cultural groups (religiously Muslims, Sikhs and Hindus) would also ascribe to EOC values.

People holding to EOC values are genuinely concerned about the decay of family and societal values, and perceive that those who ascribe to EOA values rank hedonism, the pursuit of pleasure, as more important than maintaining the social fabric.

The ethics of divinity (EOD) are concerned with the sacred, purity, and with living a life consistent with the requirements of God, generally as revealed in sacred scriptures. Those who ascribe to EOD believe in a universal moral order, ordained by God, and that to depart from it risks eternal separation from the divine in the life to come. All the world's great religions hold to these beliefs. Thus, in the area of sexual morality, EOD believers have behavioral standards much more restricted than those who hold to EOA beliefs. This is why when EOD people write publicly, they often tend to cite holy scripture as the justification for their concerns. The reaction from those in the EOA camp is often dismissive, because they generally do not subscribe to the concept of accountability to a divinely ordained universal moral code.

Heidt and Hersh found in their research, not surprisingly, that study participants from conservative church groups were much more likely to use EOD than EOA in their assessment of what types of sexual behaviors were acceptable. Atheists and the non-religious tended to use EOA in their assessments, and consequently were more accepting of non-traditional sexual behaviors.
There has been a growing tendency among those in the EOA camp to accuse those in the EOC/EOD camp of "homophobia" if they dare to speak or write publicly about their concerns. Indeed several Christians have been successfully prosecuted by gay activists in the courts and human rights tribunals for publicly expressing their opposition to homosexual behavior. Moral disapproval for certain sexual behaviors based on EOC/EOD positions ought not to be defined as an irrational or phobic reaction, however. Yet that is the sledgehammer those in the EOA camp have been employing with considerable success in the past decade. Currently, there is general acceptance of the term homophobia, and general agreement that it is a negative influence in public life.

To this end, there is a concerted effort by gay and lesbian lobby groups, and supported by teachers' unions, to implement anti-homophobia and anti-heterosexism programming in Canadian public schools. Regrettably, there has been very little attempt to accommodate the concerns of the EOC/EOD side, resulting in divisive and expensive court battles, most notably the Trinity Western University and Surrey Book cases.

Those who hold EOC/EOD positions are not prepared to compromise their religious beliefs or cultural values to accept as normative, sexual behaviors condemned by tradition or holy writ. It is necessary for those in the EOA camp to understand that EOC/EOD believers may be homo-negative towards certain sexual behaviors, but homo-positive in affirming the inherent worth of homosexual persons. This position is affirmed by all responsible religiously based social conservative organizations, but seen as unacceptable by leaders of the EOA camp. They argue that sexual orientation and the accompanying behaviors are inextricably linked, and that to condemn the behaviors is the same as condemning the person.

The EOA position that sexual orientation is inherent and unchangeable is simply not supported by social science research. Indeed, even the psychiatrist most responsible for the removal of homosexuality from manual of mental disorders (the DSM) in 1973, Dr. Robert Spitzer, has published research affirming that orientation change therapy has been shown to be beneficial and effective for the majority of his study group (Can Some Gay Men and Lesbians Change Their Sexual Orientation? 200 Participants Reporting a Change from Homosexual to Heterosexual Orientation, Archives of Sexual Behavior, October 2003, 403-417). The majority of his group were motivated by desires to marry, to maintain their marriage, or to live a life consistent with their religious beliefs.

To that end, most major religious groups in North America have established therapeutic resources for those in their faith communities who are distressed over unwanted same sex attractions, and who are motivated to re-orient towards heterosexuality. For Jews there is JONAH, Mormons have Evergreen, Catholics call theirs Courage, and Protestants have Exodus.

These organizations (including NARTH) exist because those with unwanted same-sex attractions have asked for help for dealing with their distressing symptoms. The treatment category in the DSM IV is 302.9(3) "persistent and marked distress over one's orientation." Ironically, it is a denial of the concept of autonomy for those in the EOA camp to try to prevent these people from gaining access to these types of services. Gay and lesbian lobby groups have vigorously (but unsuccessfully) lobbied the American Psychological Association to declare orientation change therapy unethical. The personal stories of those who have undergone re-orientation therapy successfully are posted at www.peoplecanchange.com.

Mandatory indoctrination of all public school children with EOA ideology in the area of sexual behavior, is profoundly disrespectful and manifestly unethical, as it violates the rights of EOC/EOD parents to transmit their values to their children. The United Nations has repeatedly affirmed that this is an inalienable right of parents. Educational authorities have delegated roles in the education of children, and do not have the right to impose an EOA value system without parental consent. Furthermore, such efforts violate the specific requirements of the BC Teachers Federation code of ethics to respect the sensibilities of their students, and to refrain from using their roles for ideological gain.

We live in a pluralistic society where a broad spectrum of values is cherished. It is the duty of public educators to acknowledge all three ethical positions. Denigrating those who adhere to ethics of community or ethics of divinity is no way to achieve social harmony, or even improved social conditions for sexual minorities. Let us agree on what we can agree on: affirmation of the inherent worth of everyone, non violence, eradication of harassment, bullying and name-calling, and promoting understanding of each other's profoundly held values. Against this ethic, there can be no argument.

Chris Kempling is a Registered Clinical Counselor and NARTH member living in Quesnel, BC Canada. Feedback at Kempling@telus.net is welcome.

Pierre Elliot Trudeau: Apologist for Totalitarianism

By George Jonas

National Post, via JeanChretien.Libertyca.net, October 16, 2000: When Pierre Elliott Trudeau died last month, many Canadians, even among those who recognized the flaws in his legacy -- his support of Soviet tyranny, his taste for command economics, and the deep fissures created by his multiculturalism -- nevertheless suspended judgment as the nation indulged in a reprise of Trudeaumania. Here, George Jonas argues that while Trudeau's charm and charisma are gone, his execrable ideas and institutions live on.

Like a flashback from a bad LSD trip, Canada has been in the grip of Trudeaumania. One standard dictionary defines "mania" as an "obsessional enthusiasm." This is at best. The primary definition is "a mental disorder characterized by great excitement." Perhaps Trudeaumania fit the kinder definition in 1967, but 33 years later it can only be defined in the primary sense. In the year 2000, obsessive partiality to Mr. Trudeau's legacy presupposes either ignorance of what his legacy is, or a mental disorder.

Mr. Trudeau walked among us between 1919 and 2000. He concerned himself with public affairs during the 55 years spanning 1942 and 1997, first as a student and journalist, then as a politician and national leader, and finally as an elder statesman. During those years, the first main domestic argument in Canada was between free enterprise and the interventionist economy, and the second between the unitary and the devolutionary state. Internationally, the main argument was between liberal democracy and totalitarianism. [emphasis added]

It's safe to say that in the first and the third of these arguments, Mr. Trudeau took the wrong side. The jury is still out on the second.

Some would argue Mr. Trudeau didn't take the wrong side between liberal democracy and totalitarianism, only the middle ground. This is silly. One cannot take the middle ground between life and death. If one proposes to conduct electricity, declaring neutrality between brass and rubber won't do. Mr. Trudeau did make a choice, and -- to stick with the same metaphor -- he chose rubber. Domestically, he favoured the command economy over free enterprise, and the unitary state over devolution. Internationally, he sided with Marxism-Leninism over liberal democracy. No wonder the lights failed to go on.

The wonder is that many of the same people who wouldn't see eye to eye with Mr. Trudeau on minimally two of the three fundamental questions that confronted him during his stewardship of Canada -- i.e. people who take the failure of Communism and the command economy for granted -- still grew misty-eyed at his passing, and spent the past two weeks extolling his legacy in near-hysterical terms.

David Frum (whose piece in The Wall Street Journal was titled "A Great Man, but a Catastrophic Prime Minister"), writing in this paper, helped to dispel one particularly misleading myth about Mr. Trudeau with his accurate description of Canada's Charter of Rights and Freedoms as "the opposite of a liberty-enhancing document." Though initially even the National Post joined the chorus of weeping and wailing, by Oct. 7, in an editorial titled "His communist pals," the paper put Mr. Trudeau's relationship with totalitarianism squarely on record. Some journalists refrained from writing about Mr. Trudeau for days after his death, because (as the columnist Michael Coren put it) "I thought it fit that he was buried before comment." Seemly as such reticence was, it allowed a deluge of appalling nonsense to inundate the media virtually unchallenged for the first number of days.

Mr. Trudeau was cut of the same cloth. He was bright, had an acid tongue and didn't suffer fools gladly. This might have been fine, except he regarded everyone who disagreed with him as a fool. Such leaders run the risk of surrounding themselves mainly with groupies, sycophants and nonentities. Mr. Trudeau was no exception. As Mr. Fulford wrote, his cabinet eventually "turned into a collection of mediocrities."

Read more

Friday, August 3, 2012

Race and IQ: Are Comparisons Intelligent?

So-called intelligence tests measure speed and accuracy in the performance of certain intellectual tasks tackled in particular ways. The idea that intelligence so measured is genetically fixed and can thus be used to differentiate among human populations or races was conclusively repudiated by James R. Flynn who found that over the last 60 years, in all countries for which data exist, intelligence test scores have shown a generational increase of from 5 to 25 points on a standard IQ test, or an average of one standard deviation.

The measured mental capacities that psychologists call intelligence must, therefore, be strongly influenced by environment. That this is so is hardly surprising. The brain is a highly plastic organ. Mozart was a genius, but without a father, himself an accomplished composer, determined to create a prodigy, Mozart's innate musical gifts would likely never have been made manifest. Raised on an 18th century Irish potato farm, Mozart would more probably have been regarded as an an idiot than an idiot savant.

In a review of the large body of data on population differences in IQ assembled by Lyn and Vanhanen in their 2001 treatise IQ and the Wealth of Nations, Ron Unz offers a plausible interpretation of the Flynn effect:
... There has been considerable speculation that this general rise in IQ-test performance is based on the increasingly complex and technological environment surrounding us, whose intricacies constantly train all of us in the sort of mental abstractions found in most IQ tests, thereby gradually raising our test scores without necessarily raising our intelligence. In effect, life in modern urban societies has become a daily cram-course for IQ tests. ...
The huge impact of social environment on  IQ that the Flynn effect reveals and the well-established relationship between IQ and wealth goes a long way toward explaining the stability of social class or racial stratification within societies. High IQ promotes economic success, economic success creates an environment conducive to the development of high IQ.  Thus a tiny elite can achieve long-lasting preeminence, while entire social or racial groups are largely denied social advancement by virtue of the constraints on intellectual development that poverty imposes.

The corollary to this conclusion is that for the disadvantaged in society to advance materially or socially it is necessary that they adopt some features of the lifestyle of those more privileged than themselves. Which means that those who blame the poverty or delinquency of the disadvantaged on society's unfairness or racism, rather than on the failure of many who are poor to strive to become what they presently are not, only help perpetuate existing class divisions.

That, surely,  is why the elites of Western nations maintain a hugely expensive educational/propaganda system that inculcates a whinging self-pitying mentality among the masses, thereby ensuring a comfortable absence of competition for wealth and power. It would also explain why old-fashioned ideas of self help through self-discipline driven by ambition are almost universally despised in the so-called liberal democracies.

But merely because socio-economic factors can be important in determining certain measures of intelligence or social success, it would be absurd to assume that genetics has no role in determining intellectual differences among individuals and groups. The structure and functioning of the mammalian brain, the most complex thing in the universe, has many genetic determinants, variation among which must contribute to the uniqueness of individuals and the distinctness of races.

An interesting racial distinction to which Ron Unz draws attention is the apparent immunity of Southeast Asians to an effect of wealth on IQ. In part, the explanation may be found in the relative conservatism of Southeast Asians, which inculcates a more or less universal drive for self-advancement through discipline and hard work, thus ensuring that individuals, irrespective of wealth, are more likely to develop whatever intellectual capacities they possess than is the case among the lower strata in other societies.

See also,
CanSpeccy: Race and IQ in America

Thursday, August 2, 2012

Pathologies of Our Peculiar Age


Taki's Mag, August 02, 2012

The USA, I’m sorry to see, is currently behind China in gold medals, 17-12.

And oh dear, there’s Britain, with only two gold medals.

It’s only Wednesday night, though—end of the fifth day, eleven still to go. I’m sure the old country will perk up and gather a few more golds. It can’t possibly be the case, as that dire opening ceremony seemed to suggest, that the entire national genius of the British is now concentrated on running hospitals, recycling old pop songs, writing whimsical stories for children, performing the national anthem in sign language, and celebrating diversity.

Or as Peter Hitchens said in a wonderfully peppery Daily Mail column:
It is a strange sort of nation that can turn a hospital bed into a symbol of national pride, especially in an era when you can die of thirst in one.
Yes, I’m trying to keep up with the Olympics. This goes against my general inclinations.

For one thing, there’s the totalitarian angle. A huge organized sporting event like this, with its son et lumière opening spectacle, hundreds of flags paraded around to the cheers of the multitude, and strong social pressure on us all to show enthusiastic approval, inevitably brings to mind the great 20th-century despotic utopias. Does the name Leni Riefenstahl mean anything?

As I blogged three Olympics ago (how time flies!):
The reason that fascists and communists love sport is, of course, that sport has no linguistic content. Totalitarians hate language and wage constant war against it — another thing Orwell taught us. Sport is therefore the ideal lowbrow entertainment from the point of view of jealous power elites, just as ballet is the ideal highbrow entertainment. The old Soviet Union poured huge resources into both.
The main venue for this year’s Olympics is in London’s East End, not far from the hyper-gentrified Isle of Dogs, where my wife and I owned a pleasant little apartment twenty-something years ago. We bought at the top of the market and sold at the bottom, for £100,000 each time. Now the damn thing is worth half a million at least. This rankles. I’d rather not be reminded. (Should I ever offer you advice about real-estate investment, run like the wind!)

The Games are like a great lens, magnifying all the pathologies of our peculiar age. The opening ceremony was one long, monstrous illustration of this truth, pathology after pathology paraded before us as if old London was a beggar displaying his sores: stagnant popular culture, progressivism’s bogus iconography, rampant “diversity,” and a kind of valetudinarian supremacy forcing our attention toward the sick and disabled even at a festival of health and strength.

Poor Muhammad Ali, who though only one of the nine bearers of the Olympic flag—and perforce a token one at that, given his sad condition—was in a way the perfect emblem of what the opening ceremony was striving for: Black! Muslim! Pacifist! Disabled!

So no, I’m not much of an Olympics fan. And yet I watch and check the medal tables.

For all the globalist twaddle, for all the PC triumphalism, for all the gross waste of public funds, for all the North Korean-style massed choirs and dance troupes (which must have been an inspiration to the actual Norks: they have four gold medals, which is more than Germany, Great Britain, and Russia have)—for all that, the Olympics are still one place where nations compare themselves with each other.

Diversify us all you like. Shower us with multicultural imagery. Open our borders to all the world’s wanderers. Teach our children to hate their ancestors and despise their own race. Make us press “2” for our own language. Still, nine out of ten people watching the Olympics, even in the terminally decadent West, are rooting for their nation (though not necessarily for the nation of their current domicile).

Well, well, no doubt we shall soon be One World, blending together in multicultural harmony. Then the true Olympic spirit will prevail: not nation against nation, only athlete against athlete.
By that time, though, as Randall Parker has speculated, the Olympic Games may be redundant:
Since super athletes have genes that make them far more able to compete some argue that sporting competitions are just elaborate games aimed at identifying who has the best genetic sequences. Great sporting competitions, whether professional or amateur, end up turning into elaborate mechanisms for filtering for the most genetically well endowed. Falling genetic sequencing costs promise to take away the need for sporting competitions for this purpose.
Then we shall be able to dispense with the events and the spectacle altogether, awarding the men’s 200-meter butterfly gold to whomever has nucleotide sequence CCTAAACTCAGTGTGGCCCTGGCCCTGTGACATGCTGGCGATGCAGTCCC at the proper locus on chromosome 12.

Hey, it’ll be cheaper.

Race and IQ: Are Comparisons Intelligent?

Canspeccy.wordpress.com, August 2, 2012:So-called intelligence tests measure speed and accuracy in the performance of certain intellectual tasks tackled in particular ways. The idea that intelligence so measured is genetically fixed and can thus be used to differentiate among human populations or races was conclusively repudiated by James R. Flynn who found that over the last 60 years, in all countries for which data exist, intelligence test scores have shown a generational increase of from 5 to 25 points on a standard IQ test, or an average of one standard deviation.

The measured mental capacities that psychologists call intelligence must, therefore, be strongly influenced by environment. That this is so is hardly surprising. The brain is a highly plastic organ. Mozart was a genius, but without a father, himself an accomplished composer, determined to create a prodigy, Mozart’s innate musical gifts would likely never have been made manifest. Raised on an 18th century Irish potato farm, Mozart would more probably have been regarded as an an idiot than an idiot savant.

In a review of the large body of data on population differences in IQ assembled by Lyn and Vanhanen in their 2001 treatise IQ and the Wealth of Nations, Ron Unz offers a plausible interpretation of the Flynn effect:
… There has been considerable speculation that this general rise in IQ-test performance is based on the increasingly complex and technological environment surrounding us, whose intricacies constantly train all of us in the sort of mental abstractions found in most IQ tests, thereby gradually raising our test scores without necessarily raising our intelligence. In effect, life in modern urban societies has become a daily cram-course for IQ tests. …
The huge impact of social environment on IQ that the Flynn effect reveals and the well-established relationship between IQ and wealth goes a long way toward explaining the stability of social class or racial stratification within societies. High IQ promotes economic success, economic success creates an environment conducive to the development of high IQ. Thus a tiny elite can achieve long-lasting preeminence, while entire social or racial groups are largely denied social advancement by virtue of the constraints on intellectual development that poverty imposes.

The corollary to this conclusion is that for the disadvantaged in society to advance materially or socially it is necessary that they adopt some features of the lifestyle of those more privileged than themselves. Which means that those who blame the poverty or delinquency of the disadvantaged on society’s unfairness or racism, rather than on the failure of many who are poor to strive to become what they presently are not, only help perpetuate existing class divisions.

That, surely, is why the elites of Western nations maintain a hugely expensive educational/propaganda system that inculcates a whinging self-pitying mentality among the masses, thereby ensuring a comfortable absence of competition for wealth and power. It would also explain why old-fashioned ideas of self help through self-discipline driven by ambition are almost universally despised in the so-called liberal democracies.

But merely because socio-economic factors can be important in determining certain measures of intelligence or social success, it would be absurd to assume that genetics has no role in determining intellectual differences among individuals and groups. The structure and functioning of the mammalian brain, the most complex thing in the universe, has many genetic determinants, variation among which must contribute to the uniqueness of individuals and the distinctness of races.

An interesting racial distinction to which Ron Unz draws attention is the apparent immunity of Southeast Asians to an effect of wealth on IQ. In part, the explanation may be found in the relative conservatism of Southeast Asians, which inculcates a more or less universal drive for self-advancement through discipline and hard work, thus ensuring that individuals, irrespective of wealth, are more likely to develop whatever intellectual capacities they possess than is the case among the lower strata in other societies.

Thursday, July 26, 2012

Why we're screwed. Or forget the economics, just follow the money

Because of the success of science, there [has emerged] a kind of pseudo-science. Social science is an example of a science that is not a science. They follow the forms, gather data, but they don't get any laws. The haven't found any yet. Maybe someday they will. [But] they are not scientific. They sit at a a typewriter and they make up something. Maybe true, maybe not true, but it has not been demonstrated.
Richard Feynman
Economics is a social science, and as Feynman implied, it is mostly bollocks.

The Australian economist, Steve Kean, has written a book called Debunking Economics. I think he was over-ambitious. I think he should have written a book called Junking Economics.

Relationships among the interacting processes of the economy can be discerned, but the economy continually evolves, with the result that the economists are always trying to apply to a new crisis what would have been the solution to the last crisis if anyone had thought of it at the time.

What's worse, they present the transient relationships among x, y, and z as immutable mathematically expressible laws and then award one another Nobel Prizes for the effort. But five years spent gaining a PhD through manipulation of some obscure bit of math will do little to help anyone understand the way the world actually works.

That is why there are few rich economists -- other than those who write the textbooks.

The futility of economics has been made abundantly clear during the present depression. The crackpot Austrian School economists say creative destruction is the way forward. Everyone's got to go bankrupt before the economy can rise, phoenix-like, cleanses of all malinvestment. That's when these nuts plan to sell their "physical" gold and silver for thousands and thousands of dollars an ounce and buy up the world -- that's if a survivalist with a gun hasn't hijacked their stash of precious metals first.

The Keynesians are equally mad. Their solution is more debt. The government must borrow without limit and keep spending until demand swells to suck the tens of millions of unemployed people back into the workforce.

As to who will pay back the debt, they tend not to dwell on that, although if pressed, all they can say is "our kids will handle it."

Then there's the question of what the Keynesians want the government to spend all that money on. They seem to think that every dollar of government spending yields a dollar's worth of public benefit, which is absurd. Most government spending goes on harassing, bullying, brainwashing or shaking down the citizen.

For example, do Americans really benefit from the Homeland Security Administration? One might as well ask whether the Germans benefited from the Gestapo.

Or would American kids be better off with more training in political correctness in the guise of education? Or would Americans be richer if the government subsidized the conversion of more grain to alcohol, or the construction of more windmills?

One could go on. But the cure for today's depression is apparent to anyone giving thought to its cause, which is that the globalized corporations took tens of millions of jobs from workers in Europe and America -- jobs paying ten, twenty, or more dollars an hour -- and gave them to Third Worlders prepared to work a 72-hour week under often dangerous and unhealthy conditions for pennies an hour, people like Steve Jobs, the Walmart Waltons and the Bill Gates pocketing the difference in pay.

Thus the cure for the poverty created by the off-shoring of jobs can only be the repatriation of the same jobs, which can be achieved in one of only two ways.

One is a tariff, much more urgently needed today than in the days of Smoot-Hawley when America had to compete only with the likes of England and France, countries no more competitive that the United States.

The other is some form of wage subsidy, such as I have outlined elsewhere (and here), that would provide employers in the West labor at a price competitive with that avaialable in the Third World, while providing workers with a living wage.

But this is all fantasy. Nobody cares about your income or whether you starve. Nobody who can do anything about it, anyhow. Well, yes, they do care. If you are earning more than a subsistence, they would like to insure that in future you earn less.

Those who rule consider you to be either a useful slave or a useless parasite. They see that in a world of high technology and automation, those who bring nothing to the workforce but a pair of hands are worth no more than pennies and hour and perhaps not even that.

Personal economic survival will increasingly depend on an ability to make oneself useful to the plutocratic elite, which means being some kind of technician able to operate the increasingly automated systems for the production and distribution of goods and the control of the population. For those lacking such talent, there is a final solution. It is called depopulation, and it will be pursued with increasing force and violence as the populace succumbs to economic stress and demoralization.

Economists who blather endlessly about the debt crisis, the financial crisis, the Eurozone crisis serve a useful purpose: they give hope where no reason for hope exists, thus distracting those who might otherwise rebel.

Nothing can effectively impede this drive for a new feudalism except the nation state, which was constructed on the ruins of medieval feudalism. Hence the genocidal assault on the nation states by the plutocratic Neofeudalists. The impoverishment of America will minimize the greatest single threat to those intent on destroying the right of the people to life, liberty and the pursuit of happiness.

Wednesday, July 25, 2012

My Dad's Home Town

My father's family came from the Leicestershire village of Sibbertoft -- at least eleven generations of them, which is as far back as church records go; although they were of Norman extraction, so the line likely extended at the same spot all the way back to 1066. the year of the Norman Conquest.

For nine generations they worked as farm laborers, although my Great Grandpa must have been literate, as he held the post of village clerk. My grandpa moved to the city of Leicester (pronounced Lester), the largest town in the East Midlands, to work in the hosiery trade upon which the 19th and early 20th century prosperity of the city was built.

For thirty years Grandpa managed the Wolsey Limited factory that stood near the centre of the city. Founded in 1755, Wolsey Limited was believed to be the oldest textile firm in England. It was named after Cardinal Wolsey who, in 1530, stopped at Leicester Abbey while on a journey from York to London to face charges of treason. Wolsey alarmed the monks by announcing that he would leave his bones among them, as he did, dying that very evening. The image of Cardinal Wolsey appears as a relief on the fifth floor facade of the Wolsey Limited factory.

My Dad's parents lived just out of town in the village of Fleckney. Dad attended the grammar school in the adjacent small town of Kibworth Beauchamp (pronounced Beecham), where he became head of school and captain of football (soccer). The year he turned 16, he passed the Senior Oxford (i.e., university entrance) exams with honours, and left school with a testimonial from the Head Master stating that "his record as a pupil at this school is better than that of any other during the last eleven years."

But in those days it was considered unnecessary for a boy of that class to enter the university. As the Head Master, an Oxford MA, further stated "a little experience will give him confidence in the abilities he undoubtedly possesses, and he will then be a very valuable worker."

So it was as a worker that Dad went into the hosiery trade, where he lived up to his promise, becoming a factory manager at 18, a managing director at 25 and sales director of a manufacturing group at 30: a promising career that was brought short by a stint in the RAF during WW2.

In 1961, when I went to Leicester as a university student, not a whole lot had changed. The Wolsey Limited factory was still humming. The city still prospered, and was said to have more Rolls Royce motor cars per capita than any other town in England. But despite the flash cars and the fine Victorian and Edwardian mansions in the suburb of Oadby, is was mainly an English working class town, a place of red brick terrace houses of various types from the two down and two up with a front door opening directly onto the sidewalk, to the better sort of lower middle class housing with a yard or two of grass in front and separated from the street by a fence of iron railings.

The relief of Cadinal Wolsey on the facade of
what used to be the Wolsey Limited factory.
Image source.
Today, Leicester is rather different. Wolsey Limited has gone. The name lives on, but only as a marketing device: a good English name to stick on foreign goods. The factory's gone too, replaced by low-cost housing, although the facade with the image of the Cardinal has been retained.

Oddly, the BBC announcer reporting the reconstruction of the building did not know how to pronounce the name Wolsey. She said it with a short "o", which is daft: they knitted socks with wool, not wol, and pronounced Wolsey with a "wool".

But the misunderstanding's to be expected. The BBC encourages the use of regional accents in regional programming and, today, the voice of Leicester is the voice of ethnic Britain. From 212 thousand in 1901, the indigenous English population of Leicester has fallen by a third, while the ethnic population, chiefly, Hindu, Muslim and Sihk, has gone from nothing to more than 51% of the population in 2011 and is still growing fast.

The English are now past the tipping point in a town that has been their home for more than 2000 years and which played a critical role in their history. They are the minority. They have been ethnically cleansed, not by a conquering army, but as a matter of deliberate policy by their own government.

Dad was a man of pacific temperament. During the 30's he was a peace activist. Yet he understood the place of violence in history, and when it came to the crunch, volunteered for service in the struggle against Nazi tyranny. He believed the independence and liberty of England was worth fighting for.

Dad was no racist. He did business with all kinds and conditions of men and formed friendships with many, including immigrants from the Indian subcontinent. But he was patriot who would have considered the likes of Blair and Cameron, Clegg and Milliband traitors for what they have done to his home town: men worth fighting to expose, depose, and punish.

Tuesday, July 24, 2012

My Britain is fuck all now

Emma West, who appeared in a YouTube video publicly bemoaning the takeover of her English town by immigrants, is both an annoyance and a threat to the politically correct British state.

Emma West. Image source
Dammit, the media can't even call her a racist. They have to call her the tram race rant accused, or the author of an alleged racist rant.

The trouble is, even if a court rules that Emma West's remarks were "racist", they cannot without absurdity, deny that they were true. So a court must declare either that truth trumps political correctness or that political correctness trumps truth. Either way, the admission will do significant damage the credibility of the politically correct state.

To be specific, here's exactly what Emma West said. And no, it's not polite. It's not what I would have had the nerve to say, even if I had been so inclined. And it might very well be deemed liable to cause a breach of the peace. But it's the truth.

For example:
What's this country come to? A load of Black people and a load of fucking Polish, a load of fucking East… Yeh.
So it's not just black people or Asians she's bothered about. She's objecting to the fact that Britain's towns and cities are being overwhelmed by foreigners, including white Polish Europeans. Then there's her response to the black woman who says:
If we don't come here you guys don't work. You guys don't work. We have to do the work for you.
How's that for the settler mentality? Racist too. But in any case, here's Emma West's response:
I work. This is my British country until you lot come over.
And that's her real offense. She's claiming England for the English.

Opposing the genocide of your own people is racism, according to the globalist shills who run all three major political parties in Britain.

Yeah, genocide. The term genocide was coined by the Polish Jew, Raphael Lemkin. To him, notwithstanding the Jewish Holocaust, genocide was not necessarily or even usually a business of bullets and poison gas:
More often it refers to a coordinated plan aimed at destruction of the essential foundations of the life of national groups so that these groups wither and die like plants that have suffered a blight. The end may be accomplished by the forced disintegration of political and social institutions, of the culture of the people, of their language, their national feelings and their religion. It may be accomplished by wiping out all basis of personal security, liberty, health and dignity. When these means fail the machine gun can always be utilized as a last resort. Genocide is directed against a national group as an entity and the attack on individuals is only secondary to the annihilation of the national group to which they belong.
And it is precisely for stating that genocide is what is happening to the English in Croydon, that the media are itching to call Emma West a Racist. And it is precisely why the state seems determined that Emma West should either plead not guilty by virtue of insanity or admit that she is a racist.

How well the state has learned the lesson spelled out in George Orwell's 1984. Love is hate, peace is war, freedom is slavery, and now thanks to the cunts ruling England since that queer sod Ted Heath kicked Cyril Osborne out of the Tory party caucus for saying England was a white country for white people, opposition to genocide is racism.

See also,

Sean Gabb: More thoughts on Emma West

Peter Hitchens: What’s that noise? They’re Building a Coffin for Liberty

Who Rules?

Andrew Gavin Marshall says it's the bankers who rule, and in particular the dynastic banking families and their network of think tanks that have:
socialised the ruling elites of each nation and the international community as a whole, into a cohesive transnational elite class. The foundations they established helped shape civil society both nationally and internationally, playing a major part in the funding – and thus coordinating and co-opting – of major social-political movements.
This is the New World Order conspiracy founded by Cecil Rhodes, his financier friends, Lord Rothschild and Alfred Beit, the journalist and long-time Editor of the Times, William Stead, and Alfred Milner, who played a central role in the shaping of British foreign policy in the post-WW1 era.

Carroll Quigley's account of this so-called Rhodes-Milner group, completed in 1949 although not published until 1981, leaves the reader to understand that by the onset of WW2 the project was dead. But we know that the Council on Foreign Relations, one of many public faces of Rhodes' project for global empire, remains very much alive and that the successors to the bankers such as J.P. Morgan and John D. Rockefeller who funded Rhodes' project in its earlier days, remain as committed as ever to global governance.

Aangirfan, in Our Secret Government, offers a different perspective. The West is ruled by a US-NATO controlled secret government that uses terror and assassination to eradicate opponents and to compel public submission to an increasingly totalitarian system of control.

These two views of the world are not necessarily incompatible. A secretive plutocratic elite, employing the media it owns, the financial resources it controls, can dictate the outcome of most elections with money and propaganda. What's more, they can heavily influence the actions of most elected officials through bribes, paid in the traditional way after the candidate leaves offices. Thus, for example, Tony Blair, a key enabler of the Iraq war is the recipient of, among many interesting income streams, an annual director's fee of more than $2 million from JP Morgan.

Thus is plutocratic control concealed by a facade of democracy. But the success of the Western system of control depends entirely on its appearance of spontaneity. Unlike the Soviets who absurdly insisted on elections in which everyone voted for the government's own candidate or went to jail, Western states have elections that can still generate excitement. Many an election looks like a cliff-hanger. Thus is preserved the illusion that the little guy has his say.

But sometimes things go wrong. The Kennedy's, with the help of Richard Daly, the resourceful mayor of Chicago, managed to stuff more ballots than Nixon's team and JFK was elected. Then Kennedy seemed to think that, as President, he could make his own decisions, not just front for someone else's. He failed to back the CIA's Bay of Pigs invasion of Cuba. Then he wimped out of a head on nuclear show-down with the Ruskies over Soviet missiles in Cuba, preferring instead to make a deal with Kruschev behind the backs of Joint Chiefs.

But Kennedy was soon gone, shot from behind in the front of the head, at near impossible range with a crap WW1 Italian rifle by a patsie befriended by an associate of George H. W. Bush who committed suicide the day, in 1977, he was to be interviewed by an investigator for the House Select Committee on Assassinations.

Soon things were back on track. LBJ, with a wink from a friend, stepped up to the Presidency and set about sending 600,000 US troops to Vietnam.

But if LBJ was complicit in the actions of elements of a secret government, he was no fool. He was a real politician with a program of his own:
The purpose of protecting the life of our nation, and preserving the liberty of our citizens is to pursue the happiness of our people. Our success in that pursuit is a test of our success as a nation. ... The challenge of the next half century is to determine whether we have the wisdom to use [our] wealth to enrich and elevate our national life and to advance the quality of our American civilization. ...The Great Society rests on abundance and liberty for all. It demands an end to poverty and racial injustice...
Not quite the plutocrat's dream. And what's that about the success of the American nation? Mentioned four times in two sentences. That ain't the politically correct empire we're aiming for.

Which suggests that at some point, the agents of plutocracy determined to get control of the process by which individuals are vaulted into leadership at a stage much earlier than the election campaign.

Does that explain the emergence of the PR flack as national leader? The Quisling non-entities, Tony Blair, Dubya, David Cameron: men with no real work experience; men who have risen without trace; men who pursue the war for global empire without hesitation; men who pursue the genocide of their own people through the destruction of their nation as a racial, cultural and religious entity; men so unerringly setting the world on course for an economic disaster that will precipitate massive global depopulation?

And if the whole apparatus of democratic government is now a charade, how has that be accomplished other than by means of a secret apparatus engaging in the most ruthless manipulation of events, including the resort to terrorism?

But how does a secret government, elements of which clearly exist, function in relation to the more or less legal and relatively transparent application of the money power to the drive for global governance?

The answer is that the two are coordinated via the security services of the various states. The security services are created by the state, but they are not necessarily subject to legitimate state authority. Mrs. Gandhi was murdered by her own bodyguard. President Sadat was murdered by his own military despite four layers of security and eight bodyguards. President Kennedy's murder depended on blatant treachery by his Secret Service bodyguard.

But if the state does not control the security services, who does?

In the answer to that question is the truth of who rules. But whoever the puppet-masters may be, of one thing we can be sure, the West is now subject to a tyranny no less evil, no less destructive of the people, and no less brutal than any that has preceded it.

Saturday, July 21, 2012

Li(E)bor Banks: Too Big to Jail

The confidence in the system is so fragile still… a disclosure of a fraud… could result in a run, just like Lehman.

Tim Geitner, US Treasury Secretary
 When the banks rush to offer $40 billion in compensation -- more than the estimated penalty to be paid by BP for the Gulf Oil Spill, the alleged greatest environmental disaster in the history of the universe -- we can be sure they are attempting to stave off much more severe punishment.

Like what?

Well how about sixteen times more severe. There were sixteen banks involved in fixing Li(E)bor. They've already agreed to contribute to a group penalty, a clear acknowledgement of guilt. So why not have each of them contribute $40 billion to a compensation fund for those who've been ripped off, this amount not to constitute a limit on their liability.

But this penalty should not come solely at the expense of bank shareholders. In the first place, the payment should be funded by repayment of all directors and traders salaries, bonuses and incentives in excess of $1 million per year for the duration of the Li(E)bor scam.

Now some would say leaving the bastards with even a million bucks a year is too generous. But remember champagne and caviar don't come cheap, and we are not proposing to force them into literal starvation.

But in addition, there must be a reconstruction of the banking industry. The high street banking sector must be separated from the investment banking business and established on a depositor-owned basis, like the credit unions, or in Britain, the Building Societies that were acquired by geniuses such as the, former sir, Fred Goodwin of the bailed out Bank of Scotland.


As for the rest of the banking industry, I recommend exile to the Bahamas or some other cockroach infested place where they could mug one another to their hearts content.

Reducing Americans to Slavery, One terrorist Attack At a Time

Colorado Batman shooting staged? 

See that's what happens when you allow citizens to bear arms. This fella was just a normal decent guy, yet he went and killed a whole lot of innocent people.  You just can't trust decent people with weapons.

Was Batman Shooter on anti-depressants?

There you are. Now that more than a quarter of adult Americans are diagnosed as mentally ill in any year and thus dependent on very expensive, very profitable and highly toxic proprietary anti-depressants and anti-psychotic drugs, you absolutely cannot trust them with guns.

Lone Wolf Domestic Terror Rhetoric Will be Used to Ban Guns

A chilling new video has surfaced on the internet at an opportune time for the establishment to push for total gun confiscation via congress and possibly through a new UN treaty.

The fact that the video is calling for “domestic terror” attacks within the United States borders is uncanny, and almost to unbelievable. ...


Or as Adolph said:
The most foolish mistake we could possibly make would be to allow the subject races to possess arms. History shows that all conquerors who have allowed their subject races to carry arms have prepared their own downfall by so doing. Indeed, I would go so far as to say that the supply of arms to the underdogs is a sine qua non for the overthrow of any sovereignty. So let's not have any native militia or native police. German troops alone will bear the sole responsibility for the maintenance of law and order throughout the occupied Russian territories, and a system of military strong-points must be evolved to cover the entire occupied country.

Adolf Hitler, dinner talk on April 11, 1942, quoted in Hitler's Table Talk 1941-44: His Private Conversations, Second Edition (1973), Pg. 425-426. Translated by Norman Cameron and R. H. Stevens. Introduced and with a new preface by H. R. Trevor-Roper.

Gun Control: The Nazi Paradigm: Steven P. Halbrook, PhD

Commented the New York Times about the interrelated rights which the Nazis destroyed wherever they went:

Military orders now forbid the French to do things which the German people have not been allowed to do since Hitler came to power. To own radio senders or to listen to foreign broadcasts, to organize public meetings and distribute pamphlets, to disseminate anti-German news in any form, to retain possession of firearms--all these things are prohibited for the subjugated people of France . . . .7
While the Nazis made good on the threat to execute persons in possession of firearms, the gun control decree was not entirely successful. Partisans launched armed attacks. But resistance was hampered by the lack of civilian arms possession.