Wednesday, August 29, 2012

An American Politician Who Does Oratory

Via the Drudge Report


The Hon. Chris Christie
Governor of New Jersey
Remarks as Prepared for Delivery at Republican National Convention
August 28, 2012
Tue Aug 28 2012 21:26:40 ET

**Exclusive**

This stage and this moment are very improbable for me.

A New Jersey Republican delivering the keynote address to our national convention, from a state with 700,000 more Democrats than Republicans.

A New Jersey Republican stands before you tonight.

Proud of my party, proud of my state and proud of my country.

I am the son of an Irish father and a Sicilian mother.

My Dad, who I am blessed to have with me here tonight, is gregarious, outgoing and loveable.

My Mom, who I lost 8 years ago, was the enforcer. She made sure we all knew who set the rules.

In the automobile of life, Dad was just a passenger. Mom was the driver.

They both lived hard lives. Dad grew up in poverty. After returning from Army service, he worked at the Breyers Ice Cream plant in the 1950s. With that job and the G.I. bill he put himself through Rutgers University at night to become the first in his family to earn a college degree. Our first family picture was on his graduation day, with Mom beaming next to him, six months pregnant with me.

Mom also came from nothing. She was raised by a single mother who took three buses to get to work every day. And mom spent the time she was supposed to be a kid actually raising children - her two younger siblings. She was tough as nails and didn't suffer fools at all. The truth was she couldn't afford to. She spoke the truth - bluntly, directly and without much varnish.

I am her son.

I was her son as I listened to "Darkness on the Edge of Town" with my high school friends on the Jersey Shore.

I was her son as I moved into a studio apartment with Mary Pat to start a marriage that is now 26 years old.

I was her son as I coached our sons Andrew and Patrick on the fields of Mendham, and as I watched with pride as our daughters Sarah and Bridget marched with their soccer teams in the Labor Day parade.

And I am still her son today, as Governor, following the rules she taught me: to speak from the heart and to fight for your principles. She never thought you get extra credit for just speaking the truth.

The greatest lesson Mom ever taught me, though, was this one: she told me there would be times in your life when you have to choose between being loved and being respected. She said to always pick being respected, that love without respect was always fleeting -- but that respect could grow into real, lasting love.

Now, of course, she was talking about women.

But I have learned over time that it applies just as much to leadership. In fact, I think that advice applies to America today more than ever.

I believe we have become paralyzed by our desire to be loved.

Our founding fathers had the wisdom to know that social acceptance and popularity is fleeting and that this country's principles needed to be rooted in strengths greater than the passions and emotions of the times.

Our leaders today have decided it is more important to be popular, to do what is easy and say "yes," rather than to say no when "no" is what's required.

In recent years, we as a country have too often chosen the same path.

It's been easy for our leaders to say not us, and not now, in taking on the tough issues. And we've stood silently by and let them get away with it.

But tonight, I say enough.

I say, together, let's make a much different choice. Tonight, we are speaking up for ourselves and stepping up.

We are beginning to do what is right and what is necessary to make our country great again.

We are demanding that our leaders stop tearing each other down, and work together to take action on the big things facing America.

Tonight, we choose respect over love.

We are not afraid. We are taking our country back.

We are the great grandchildren of men and women who broke their backs in the name of American ingenuity; the grandchildren of the Greatest Generation; the sons and daughters of immigrants; the brothers and sisters of everyday heroes; the neighbors of entrepreneurs and firefighters, teachers and farmers, veterans and factory workers and everyone in-between who shows up not just on the big days or the good days, but on the bad days and on the hard days.

Each and every day. All 365 of them.

We are the United States of America.

Now we must lead the way our citizens live. To lead as my mother insisted I live, not by avoiding truths, especially the hard ones, but by facing up to them and being the better for it.

We cannot afford to do anything less.

I know because this was the challenge in New Jersey.

When I came into office, I could continue on the same path that led to wealth, jobs and people leaving the state or I could do the job the people elected me to do - to do the big things.

There were those who said it couldn't be done. The problems were too big, too politically charged, too broken to fix. But we were on a path we could no longer afford to follow.

They said it was impossible to cut taxes in a state where taxes were raised 115 times in eight years. That it was impossible to balance a budget at the same time, with an $11 billion deficit. Three years later, we have three balanced budgets with lower taxes.

We did it.

They said it was impossible to touch the third rail of politics. To take on the public sector unions and to reform a pension and health benefit system that was headed to bankruptcy.

With bipartisan leadership we saved taxpayers $132 billion over 30 years and saved retirees their pension.

We did it.

They said it was impossible to speak the truth to the teachers union. They were just too powerful. Real teacher tenure reform that demands accountability and ends the guarantee of a job for life regardless of performance would never happen.

For the first time in 100 years with bipartisan support, we did it.

The disciples of yesterday's politics underestimated the will of the people. They assumed our people were selfish; that when told of the difficult problems, tough choices and complicated solutions, they would simply turn their backs, that they would decide it was every man for himself.

Instead, the people of New Jersey stepped up and shared in the sacrifice.

They rewarded politicians who led instead of politicians who pandered.

We shouldn't be surprised.

We've never been a country to shy away from the truth. History shows that we stand up when it counts and it's this quality that has defined our character and our significance in the world.

I know this simple truth and I'm not afraid to say it: our ideas are right for America and their ideas have failed America.

Let's be clear with the American people tonight. Here's what we believe as Republicans and what they believe as Democrats.

We believe in telling hard working families the truth about our country's fiscal realities. Telling them what they already know - the math of federal spending doesn't add up.

With $5 trillion in debt added over the last four years, we have no other option but to make the hard choices, cut federal spending and fundamentally reduce the size of government.

They believe that the American people don't want to hear the truth about the extent of our fiscal difficulties and need to be coddled by big government.

They believe the American people are content to live the lie with them.

We believe in telling seniors the truth about our overburdened entitlements.

We know seniors not only want these programs to survive, but they just as badly want them secured for their grandchildren.

Seniors are not selfish.

They believe seniors will always put themselves ahead of their grandchildren. So they prey on their vulnerabilities and scare them with misinformation for the cynical purpose of winning the next election.

Their plan: whistle a happy tune while driving us off the fiscal cliff, as long as they are behind the wheel of power.

We believe that the majority of teachers in America know our system must be reformed to put students first so that America can compete.

Teachers don't teach to become rich or famous. They teach because they love children.

We believe that we should honor and reward the good ones while doing what's best for our nation's future - demanding accountability, higher standards and the best teacher in every classroom.

They believe the educational establishment will always put themselves ahead of children. That self-interest trumps common sense.

They believe in pitting unions against teachers, educators against parents, and lobbyists against children.

They believe in teacher's unions.

We believe in teachers.

We believe that if we tell the people the truth they will act bigger than the pettiness of Washington, D.C.

We believe it's possible to forge bipartisan compromise and stand up for conservative principles.

It's the power of our ideas, not of our rhetoric, that attracts people to our Party.

We win when we make it about what needs to be done; we lose when we play along with their game of scaring and dividing.

For make no mistake, the problems are too big to let the American people lose - the slowest economic recovery in decades, a spiraling out of control deficit, an education system that's failing to compete in the world.

It doesn't matter how we got here. There is enough blame to go around.

What matters now is what we do.

I know we can fix our problems.

When there are people in the room who care more about doing the job they were elected to do than worrying about winning re-election, it's possible to work together, achieve principled compromise and get results.

The people have no patience for any other way.

It's simple.

We need politicians to care more about doing something and less about being something.

Believe me, if we can do this in a blue state with a conservative Republican Governor, Washington is out of excuses.

Leadership delivers.

Leadership counts.

Leadership matters.

We have this leader for America.

We have a nominee who will tell us the truth and who will lead with conviction. And now he has a running mate who will do the same.

We have Governor Mitt Romney and Congressman Paul Ryan, and we must make them our next President and Vice President.

Mitt Romney will tell us the hard truths we need to hear to put us back on the path to growth and create good paying private sector jobs again in America.

Mitt Romney will tell us the hard truths we need to hear to end the torrent of debt that is compromising our future and burying our economy.

Mitt Romney will tell us the hard truths we need to hear to end the debacle of putting the world's greatest health care system in the hands of federal bureaucrats and putting those bureaucrats between an American citizen and her doctor.

We ended an era of absentee leadership without purpose or principle in New Jersey.

It's time to end this era of absentee leadership in the Oval Office and send real leaders to the White House.

America needs Mitt Romney and Paul Ryan and we need them right now.

There is doubt and fear for our future in every corner of our country.

These feelings are real.

This moment is real.

It's a moment like this where some skeptics wonder if American greatness is over.

How those who have come before us had the spirit and tenacity to lead America to a new era of greatness in the face of challenge.

Not to look around and say "not me," but to say, "YES, ME."

I have an answer tonight for the skeptics and the naysayers, the dividers and the defenders of the status quo.

I have faith in us.

I know we can be the men and women our country calls on us to be.

I believe in America and her history.

There's only one thing missing now. Leadership. It takes leadership that you don't get from reading a poll.

You see, Mr. President - real leaders don't follow polls. Real leaders change polls.

That's what we need to do now.

Change polls through the power of our principles.

Change polls through the strength of our convictions.

Tonight, our duty is to tell the American people the truth.

Our problems are big and the solutions will not be painless. We all must share in the sacrifice. Any leader that tells us differently is simply not telling the truth.

I think tonight of the Greatest Generation.

We look back and marvel at their courage - overcoming the Great Depression, fighting Nazi tyranny, standing up for freedom around the world.

Now it's our time to answer history's call.

For make no mistake, every generation will be judged and so will we.

What will our children and grandchildren say of us? Will they say we buried our heads in the sand, we assuaged ourselves with the creature comforts we've acquired, that our problems were too big and we were too small, that someone else should make a difference because we can't?

Or will they say we stood up and made the tough choices needed to preserve our way of life?

I don't know about you, but I don't want my children and grandchildren to have to read in a history book what it was like to live in an American Century.

I don't want their only inheritance to be an enormous government that has overtaxed, overspent and over-borrowed a great people into second-class citizenship.

I want them to live in a second American Century.

A second American Century of strong economic growth where those who are willing to work hard will have good paying jobs to support their families and reach their dreams.

A second American Century where real American exceptionalism is not a political punch line, but is evident to everyone in the world just by watching the way our government conducts its business and everyday Americans live their lives.

A second American Century where our military is strong, our values are sure, our work ethic is unmatched and our Constitution remains a model for anyone in the world struggling for liberty.

Let us choose a path that will be remembered for generations to come. Standing strong for freedom will make the next century as great an American century as the last one.

This is the American way.

We have never been victims of destiny.

We have always been masters of our own.

I won't be part of the generation that fails that test and neither will you.

It's now time to stand up. There's no time left to waste.

If you're willing to stand up with me for America's future, I will stand up with you.

If you're willing to fight with me for Mitt Romney, I will fight with you.

If you're willing to hear the truth about the hard road ahead, and the rewards for America that truth will bear, I'm here to begin with you this new era of truth-telling.

Tonight, we choose the path that has always defined our nation's history.

Tonight, we finally and firmly answer the call that so many generations have had the courage to answer before us.

Tonight, we stand up for Mitt Romney as the next President of the United States.

And, together, we stand up once again for American greatness.

Tuesday, August 28, 2012

BBC: The British Brainwashing Corporation

The BBC is, was and always has been Britain's principal propaganda agency. Founded in 1922 as the British Broadcasting Company, under the management of the monstrous hypocrite, Lord Reith, the BBC was soon to prove its worth to the government in its handling of news and comment during the 1926 General Strike, when it  accepted a government veto on broadcast comment by both Trades Union leaders and the opposition Labour Party leader, Ramsay MacDonald.

In response to criticism of these acts of censorship by Philip Snowden, a former Labour Chancellor of the Exchequer, Reith stated:
... We do not believe that any other Government, even one of which Mr Snowden was a member, would have allowed the broadcasting authority under its control greater freedom than was enjoyed by the BBC during the crisis.
Today, the BBC spends more than five billion pounds a year, mainly money extorted as a license fee from anyone with a television set, to ensure that the British public is well and truly indoctrinated.

The degrading obscenity and treasonous intent of BBC propaganda is well illustrated with macabre humor by Robert Henderson's essay: The Archers – an everyday story of simple ever more politically correct folk.

See also:
Israeli lies unchecked, Palestinian perspectives censored on BBC
The BBC's worst scandal lies in our courts 
 BBC shows "Green Square" in INDIA, 24 August 2011

And much much more.

Monday, August 27, 2012

Olympic Requiem... ...in the ‘Indigenocidal’ State

By Colin Liddell



Alternative Right, Tuesday, 14 August 2012: Here in the UK the London Olympic Games have been considered a great success. After two weeks of competition, the British Olympic team has won an astounding 29 gold medals and has finished third in the medals table, above the mighty Russians and below only the USA and China. One of the most mentioned facts in recent days is the single gold medal we won at the 1996 Olympics. On the naïve level of simple, uncomplicated sporting enthusiasm it has been a resounding success, and an easy sell to the sporting inclinations of the UK public.

But looking at the bigger picture, the hidden agendas, and the crunched numbers, a different picture starts to emerge; one that suggests Britain’s Olympic success is merely the phosphorescent glow of an entity walking in death’s shadow.

When London won the ‘privilege’ of hosting the Olympics back in 2005, the British public were assured that the Games would boost the UK economy. As we entered the period of economic turbulence and prolonged recession that followed the Subprime Crash, the idea of the Olympics as an economic panacea became ever more entrenched. This was despite the fact that the last four Olympics all saw dramatic downturns in tourist revenues in the countries that hosted them. The present Olympics have revealed a similar pattern, with reports of the number of normal tourists driven away by security and congestion fears far outweighing the number of sports enthusiasts popping into town for their particular obsessions.

The bean counters in London – and London is a city that is mainly famous for its bean counters – certainly had more than an inkling that this would be the effect, especially as the UK has long been oversold as a tourist destination.

But the Olympic spectacle, despite the excesses of sponsorship and corporate hijacking, is not about profit so much as propaganda for the nation that hosts the event. With Beijing 2008 the intent was clear: China wanted to fluff up its image from being a giant, totalitarian sweatshop to something a little cuddlier for its Western trading receptors. In the case of London 2012 the propaganda agenda was more subtle, but obvious to anyone watching the multi-cultural-friendly, multi-channel coverage from the BBC from an un-brainwashed state.

So, why did Britain shoot itself in the foot economically by pumping billions of pounds to put on an Olympic Games that actually harmed tourist revenue? The answer is because it has become an “indigenocidal state,” that is a state in which the demographic trends lead inexorably towards the destruction of the racial character of the nation’s original inhabitants.

There are several stages in this process, and Britain is probably in the early middle phase, where the original inhabitants have been culturally and politically disarmed, and in which minority groups and mixed race groups are growing fast. At this stage the indigenocidal state has two main concerns:

(1)  It must prevent the indigenous inhabitants perceiving their gradual genocide or prevent them seeing this in negative terms.
(2)  It must prevent the colonizing ethnic minorities from being alienated to such an extent that their behaviour triggers off strong racial awareness among the indigenous group.
The engine driving this can either be a traitorous elite that feels contempt for its common people, which in a British context may be related to the class system as well as to the influence of globalist elements. Alternatively it could simply be driven by a ratchet effect that stems from economic factors, as any attempt to reverse the indigenocidal state would involve serious economic and political costs in the short-term.

The propaganda needs of the UK indigenocidal state explains why London pulled out all the stops to be selected as host city. The intention behind the Olympics became clear in the opening ceremony. To placate Britain’s Muslims the design for Team GB’s tracksuits and sportswear incorporated a blue cross of Saint George in the Union Jack pattern instead of a red one because the red cross was once a crusading symbol.

Most viewers were impressed by the opening ceremony pageant. This presented a potted history of Britain that devalued past ages and was heavily weighted in favour of the multicultural present. It reduced thousands of years of British history to three simplistic stages:
(1) Idyllic peasant society
(2) Industrialization scarring the landscape and oppressing the people
(3) Post-industrial healing through socialized medicine and multiculturalism
By highlighting the large number of non-White immigrants employed in the National Health Service, the pageant skilfully linked something the British public have deep misgivings about with something they have a great deal of belief in.

The content and tone of the pageant and the Olympic coverage that followed it focused disproportionately on Blacks. In the context of what happened in London last summer, when the city was shaken by riots, this could be viewed as abject appeasement.

During the pageant, there was a section that prominently featured race mixing as a positive and a thing to be taken entirely for granted. We saw a household with a Black father and White mother and their mulatto daughter, who lost her mobile phone which was then returned to her by a Black youth whom she then rewarded by kissing. The presumption was that they would then raise the next generation of even blacker Britons.

In addition to acclimatizing White Britons to having their daughters seduced and impregnated by Blacks, this segment seemed designed to send out a strong message to young Black males that they were not excluded, but are in fact valued and privileged members of society.

This is certainly the case for the British Olympic Committee, which goes out of its way to promote non-White athletes. The most obvious case of this was selection of Lutalo Mohammed (Black) instead the World number one Aaron Cook (White) to represent Britain in the under-80kg Taekwondo competition. Mohammed being Black and having a Muslim name was just too great a temptation for the box-ticking Team GB selectors to resist.

But why is it important for non-White and especially Black athletes to do well for Britain? The real answer is of course completely taboo. It is because, despite the best efforts of British society, Blacks are not the same as Whites and even with incessant affirmative action still find it difficult to achieve “equality.” Their lack of ability in most areas of expertise drives them to focus on those activities where their abilities can count or which are allocated to them by the wider society as part of a kind of caste system. As in other Western countries this is usually low-grade crime, music entertainment, and some sports. Having Black athletes winning gold medals for the UK is perhaps the easiest way to create an illusion of positive, high-profile social inclusion.

In these Olympics Britain’s Black athletes did reasonably well. There were two boxing golds from Afro-Caribbeans – one male and one female – while Mohamed Farar, a refugee from Somalia, won two more gold medals in long distance running. The mulatto athlete Jessica Ennis also won the high-profile Heptathlon.

This meant that five of the UK’s 29 gold medals were won by Non-Whites, or around one sixth. But this proportion was still much lower than expected or hoped for. The script was for Blacks to feature much more prominently. The actual results meant that the media had to work harder to magnify the Black contribution to Britain’s medal tally and to the Olympics in general (Bolt mania) while subtly downplaying White success.

The proportion of Black medal winners in the UK’s tally was limited by two factors: Black failures and White successes. Because Black British athletes enjoy a degree of favouritism, they can often under-perform in competition. Lutalo Mohammed, the Taekwondo fighter, for example, ended up winning only a bronze. But a more significant and interesting factor was the success of Britain’s White athletes. But this success is not what it seems.

Any Olympic success is built on a mountain of training as well as a heap of also-rans who found out the hard way they didn’t have what it takes to succeed at a particular sport. Quite simply, sport is a losing game for most people. If you come from a minority that has shown little aptitude for anything else, then it makes sense to dedicate years of your life to the possibility of winning Olympic gold, as you have nothing to lose and nothing to gain elsewhere, especially if the society you live in supports this. This is quite opposite from the situation traditionally faced by bright young Whites. In the past, the large number of careers and opportunities offering a much more reliable chance of success and demanding less in the way of sacrifice meant that there was little temptation to get deeply involved in sport. Britain’s impressively high medal tally suggests that this is no longer the case.

A combination of recession, austerity, outsourcing, cheap immigrant labour, affirmative action (a.k.a. anti-White racism), and the rise of short-term contract work over permanent employment is now putting the squeeze on the kind of people who would never have dedicated their lives to sport before. For these people sport has now becoming the same kind of low-chance escape that it has always been for Blacks. In other words, intelligent and driven young White people have now been pushed by our society into the position once occupied by ethnic minorities. Gold medals won by Whites are now also tickets out of the ghetto. Celebrate that, Britain!

Nurse Who "Saw Everything" After Suspicious Batman Shooting Found Dead




TheEndRun.com, Aug 17, 2012: Jenny Gallagher, a nurse who treated victims of the highly suspicious “Batman” shooting in Aurora, Colorado last month, is dead at age 46. The reported cause of death: drowning.

“She worked the morning after the Batman massacre in a very busy unit of the hospital — so she saw everything really, some really bad injuries,” her husband Greg reportedly told Ireland’s Herald earlier today.

The mass-shooting, which left 12 dead and 58 more injured at a midnight premiere of The Dark Knight Rises at Century theater, is widely suspected to have been a black operation (akin to Columbine or the Sikh Temple shooting) based on the available evidence, numerous inconsistencies and implausibilities in the “official story”, the timing, and the way the event has been framed (some would say exploited) by certain powerful interests in the media and political arena.  See for example…

Obama Seeks US Congressional Ratification of UN Global Gun Control Treaty, Susanne Posel  (July 16)
Colorado Batman shooting shows obvious signs of being staged, Natural News (July 20)
James Holmes Batman shooting to justify UN small arms treaty gun grab?, Mike Adams (July 21)
Eyewitness: Second Shooter in Batman Massacre, YouTube, (July 21)
Witness: Someone let gunman inside Colorado movie theater, CNN/PrisonPlanet.com (July 22)
Colorado University Had Identical Drill On Same Day As ‘Batman’ Massacre, Paul Joseph Watson (July 23)
Shooter James Holmes and DARPA Weird Science, Kurt Nimmo/Wayne Madsen (July 24)
Fox News Channel Questions Narrative Of ‘Batman’ Massacre, Infowars/WXIX-Fox19 (July 25)
Gun Owners of America President Larry Pratt: Batman Shooting Could be Staged (July 27)
James Holmes Is Behaving Like Sirhan Sirhan, Paul Joseph Watson, (July 27)
Why Are Republicans Calling To Disarm The American People?, Paul Joseph Watson, (July 30)
The Batman op expands: you shot those people, Jon Rappoport (Aug 3)

Saturday, August 25, 2012

Russia in the Middle East: Return of a superpower?

 
The world is living through a veritable slow-motion earthquake. If things go according to plan, the US obsession with Afghanistan and Iraq will soon be one of those ugly historical disfigurements that -- at least for most Americans -- will disappear into the memory hole.

Like Nixon and Vietnam, US President Barack Obama will be remembered as the president who "brought the troops home". But one cannot help but notice the careful calibration of these moves to fit the US domestic political machine -- the Iraqi move to show Americans that things on the international front are improving (just don't mention Guantanamo), the Afghan move put off conveniently till President Barack Obama's second term, when he doesn't need to worry about the fallout electorally if things unravel (which they surely will).

Of course, Russia lost big time geopolitically when the US invaded Afghanistan, and thus gains as regional geopolitical hegemon by the withdrawal of US troops from Central Asia. Just look at any map. But American tentacles will remain: Central Asia has no real alternative economically or politically anymore to the neoliberal global economy, as Russia no longer claims to represent a socialist alternative to imperialism. The departure of US troops and planes from remote Kyrgyzstan will not be missed -- except for the hole it leaves in the already penurious Kyrgyz government's budget and foreign currency reserves. Russia is a far weaker entity than the Soviet Union, both economically and politically. Thus, Russia's gain from US weakness is not great.

Obama vs. Romney: a Close Election! You gotta be kidding!

By Luke Hiken and Marti Hiken

 ProgressiveAvenues.org, August 24, 2012: We are entering the last stages of what appears to be an incredibly close election for the office of President of the United States. That Barak Obama, an opportunistic, unprincipled sell-out would be running neck and neck with Mitt Romney, a chameleon-like, vacillating, multi-millionaire who would sell his own mother to pick up a few electoral votes, is an hilarious contradiction. It is fortunate that Romney does not take his campaign on the road, because if he were to do so, he would probably forget who he was traveling with, and leave Ryan tied to the roof of his car as he drove from city to city.

How is it possible that this will be a close election? After all, Obama is a good-looking, articulate man who talks as though he actually cares about people. Romney, on the other hand, is so patently dishonest that no one in the country can identify an issue that he has not waffled on. He has even gone so far as to refuse to share his tax records with a public that recognizes what a manipulative opportunist he is. His tax records would undoubtedly provide stand-up comics with enough material to keep an audience in stitches for years to come. So why is the election not a foregone conclusion?


The reason is obvious: Obama has not spoken a truthful word in the four years since he took office. The only campaign promise he has kept was to raise a billion dollars to get re-elected. Every other promise, from closing Guantanamo, to ending the wars in the Middle East, from the NDAA to controlling the Pentagon budget and to deporting more immigrants than Bush -- everything he said has turned out to be a lie. The list of broken promises set forth in the section of the Progressive Avenues website entitled “Obama’s Hypocrisy” identifies the depth and breadth of his shameful conduct while in office. They need not be reiterated here. Romney’s hopes in this election have nothing to do with his own qualifications or integrity. On the contrary, he is even more of a danger to peace and prosperity than Obama, but how does one choose between a proven failure and the one who might take his place? Even the marginal benefits of an Obama appointment to the Supreme Court does not make up for the criminal foreign and domestic policies of this President.

WikiLeaks: Advancing an Israeli Agenda?

By Maidhc Ó Cathail

maidhcocathail.wordpress.com, December 11, 2010:

Like 9/11, WikiLeaks has been singularly good for Israel.

Asked on the night of September 11, 2001 what the terrorist attacks meant for U.S.-Israel relations, Benjamin Netanyahu, the then former prime minister, tactlessly but accurately replied, “It’s very good.” And on the day after WikiLeaks’ publication of U.S. diplomatic cables, Netanyahu “strode” into a press conference at the Israeli Journalists Association, looking “undoubtedly delighted” with the group’s latest embarrassment of U.S. President Barack Obama.

“Thanks to WikiLeaks,” Aluf Benn wrote in Haaretz, “there is now no fear Washington will exert heavy pressure on Israel to freeze settlement construction or to accelerate negotiations on a withdrawal from the territories.” Instead, also courtesy of WikiLeaks, the world’s attention had been shifted exactly where a “vindicated” Netanyahu wanted it – toward Iran’s non-existent nuclear weapons programme.

“Our region has been hostage to a narrative that is the result of 60 years of propaganda, which paints Israel as the greatest threat,” Netanyahu told the assembled journalists. “In reality leaders understand that that view is bankrupt. For the first time in history there is agreement that Iran is the threat.” While there is considerable dispute about the extent to which Arab leaders share Netanyahu’s understanding of “the Iranian threat,” the Arab public overwhelmingly considers Israel to be a far greater threat.

Thursday, August 23, 2012

Something to like about Niall Ferguson: he hates liberal bloggers

Whether the outcome of the US presidential election will make any real difference to the course of world events seems difficult to judge. Neither candidate appears to have the slightest respect for the US Constitution, the only thing that clearly distinguishes America from any other fascist imperialist state.

But whether or not Romney would make a good president, or at least a less bad president that Obama, there can be no doubt that for four years Obama has presided while tens of millions of Americans have suffered the misery and humiliation of unemployment and America's geopolitical standing has declined.

But even reasoned criticism of Obama's lack of success in restoring American prosperity is intolerable to some liberal geniuses of academic economics. It is, therefore, a pleasure to see Ferguson crush some nits picked by elite members of the liberal economics bloggerazi, who it seems were intolerably provoked by Ferguson's earlier critique of Obama's leadership in the economic sphere.

Monday, August 20, 2012

The Trouble With the Information Age: The Information Is Mostly Crap

The trouble with having access to a limitless quantity of books, newspapers, magazines, television, the alternative media, and the statements of educators is that we rarely have means of knowing what of this so-called information is true.

In the distant past, when ignorance was near universal, what people knew, they knew from the facts of often hard experience. They knew that steam scolds, frost freezes, that there is no free lunch except by theft and that civil authority rests on brute force: all of which small stock of information was incontrovertibly true.

Today, by contrast, our knowledge is not only incomparably greater, it is mostly bunk. We believe, for example, that 19 more or less clueless Muslims with paper knives beat NORAD, the World's most expensive air defense system, and that, quite reasonably, no one was fired for NORAD's failure. We know that's true because all the media say so, because no book from a reputable publisher argues otherwise, and because any scholar who argues otherwise is promptly ousted from the groves of academe.

In addition, we believe that because some 19th Century bond trader named David Ricardo pointed out the rather obvious fact that, in international trade, countries benefit by specializing in what they do best, it is therefore an excellent idea for capitalists and bankers to take the capital accumulated in the West through the sweat of generations and invest it, along with the best of Western technology, in the Third World where wages are only three to 10% of those in the West, thereby robbing workers in the West of their livelihood, while enriching said captalists and bankers. This notwithstanding that David Ricardo explicitly stated that capital exports would negate the benefit of international trade to the country exporting capital.

Then, as the US builds out a totalitarian police state fronted by lightweight democratic puppets such as Dubya the torture president and Obama the Assassin, the "information"-rich American public express their confidence in the modern incarnation of the Gestapo.

Some, skeptical of the so-called mainstream media, look to the Internet and the alternative media for "true facts" about the world. But we know that Obama's modern incarnation of the Committee of Public Information has been set to work under the direction of erstwhile "Information Tzar," Cass Sunstein, to infiltrate the alt. media and destroy whatever integrity they may otherwise have had.

Even books, or perhaps one should say especially books, are now a source of very questionable "information." Matt Ridley's "The Rational Optimist" (rated a "Best Book of the Year" by the Economist Magazine) comes to mind. Ridley, which is to say, the 5th Viscount Ridley, FRSL, FMedSci, DL, Eton, Oxford, author of TED.com talk "when ideas have sex" viewed 1.4 million times, author of award winning books, great grandson of architect Sir Eward Lutyens, nephew of a tory cabinet minister, etc., etc.)  would seems to be a well-educated chap and someone you might reasonably expect to tell you something worth knowing. But you'd be wrong.

Ridley's books is riddled with crass errors or outright lies.

Taking Adam Smith's now universally accepted insight that prosperity depends on the division and specialization of labor, Ridley offers seemingly superfluous support for the concept through examination of the way in which small populations are unable to achieve a high division and specialization of labor and thus suffer from poverty. An example he takes is that of the now extinct Tasmanians who, few in number and confined to an island, gradually lost many of the skills possessed by their ancestors who populated Tasmania before the land bridge to the Australian subcontinent disappeared many thousands of years ago.

Then he says, "In contrast to Tasmania, Tierra del Fuego -- an island not much bigger than Tasmania, home to not many more people and generally rather colder and less hospitable, -- possessed a race of who, when Charles Dawin met them in 1834, set bait for fish, nets for seals, ... used hooks and harpoons .... and clothing. [the difference between the two populations being] that the Fuegians were in fairly frequent contact with other people across the straight of Magellan so they could relearn lost skills..."

This must seem an odd claim to anyone who has actually read Darwin's account of his visit to Tierra del Fuego:
While going one day on shore near Wollaston Island, we pulled alongside a canoe with six Fuegians. These were the most abject and miserable creatures I anywhere beheld. On the east coast the natives, as we have seen, have guanaco cloaks, and on the west they possess seal-skins. Amongst these central tribes the men generally have an otter-skin, or some small scrap about as large as a pocket-handkerchief, which is barely sufficient to cover their backs as low down as their loins. It is laced across the breast by strings, and according as the wind blows, it is shifted from side to side. But these Fuegians in the canoe were quite naked, and even one full-grown woman was absolutely so. It was raining heavily, and the fresh water, together with the spray, trickled down her body. In another harbour not far distant, a woman, who was suckling a recently-born child, came one day alongside the vessel, and remained there out of mere curiosity, whilst the sleet fell and thawed on her naked bosom, and on the skin of her naked baby! These poor wretches were stunted in their growth, their hideous faces bedaubed with white paint, their skins filthy and greasy, their hair entangled, their voices discordant, and their gestures violent.... At night, five or six human beings, naked and scarcely protected from the wind and rain of this tempestuous climate, sleep on the wet ground coiled up like animals. Whenever it is low water, winter or summer, night or day, they must rise to pick shellfish from the rocks; and the women either dive to collect sea-eggs, or sit patiently in their canoes, and with a baited hair-line without any hook, jerk out little fish. If a seal is killed, or the floating carcass of a putrid whale is discovered, it is a feast; and such miserable food is assisted by a few tasteless berries and fungi. ...
Hardly convincing evidence, one would have thought, for the contention that the Fuegians were more prosperous than the Tasmanians or anyone else by virtue of their cultural connection with the larger mainland community. 

But if one ludicrous misrepresentation of Charles Darwin by a graduate in Zoology with first class honors from the University of Oxford does not a Lord Haw Haw of the New World Order make, what is one to make of the Right Honorable Lord Ridley's energetic rebuttal of those who say that "'Wal-Mart is the world's largest sweatshop' for paying low wages even though Wal-Mart pays twice the minimum wage..."

Ha! There you are, Wal-Mart is not evil. On the contrary, they provide thousands and thousands of Americans with darned good jobs. And if you doubt that you'll find his Lordship's book has lots more about Sam Walton's prosperity-generating Wal-Mart stores, which according to Ridley provide "enormous benefits that (especially the poorest) customers reap in terms of cheaper more varied and better goods." 

But Ridley has nothing whatever to say about Wal-Mart forcing suppliers to offshore production destroying good jobs for Wal-Mart's "poorest customers" in the process. And as for the claim about Wal-Mart paying twice the minimum wage, that seems as inaccurate as his Lordship's recollection of Darwin's account of the life of the Fuegians. And in fact, Lord Matty would have us believe that Wal-Mart employees, like the Fuegians, really have a jolly high standard of life.

Yet, as Henry Blodgett writes in the Business Insider,
Walmart pays its average "associate," of which it has about 1.5 million in the U.S., just under $12 an hour. This equates to an annual salary that is below the poverty line.
Moreover, employee comments reveal Wal-Mart to be a company heartily loathed by many of its employees who consider it to be both exploitive and abusive. And Wal-Mart does not hesitate, apparently, to cheat workers outright. But then how else would the Walton family's wealth have come to exceed that of the poorest 120 million Americans.

And so the book goes: everything is for the best in this the best possible of all capitalist worlds. Corporations are not evil. It is to the corporations we owe our liberty. Corporations are weak and vulnerable, yet they have brought prosperity and freedom, ended slavery, cruelty, child abuse and oppression. I'm not making this up, but I cannot quote the whole insane book.

And the beauty of capitalism, says Ridley, is that no one is in charge. Everything works to achieve greater and greater happiness for all through the working of the collective intelligence.That 146 corporations, including banks such as Barclays, Deutsche Bank, Goldman Sachs and JP Morgan control almost half of all international business activity, or that these corporations largely finance our so-called democratic election campaigns and the think tanks such as the Council on Foreign Relations that advise governments, is not something Matt Ridley would have you worry about. He refrains even from mentioning such potentially worrying facts. But then Ridley was himself a banker: specifically, the Chair of Northern Rock during the years leading to its bankruptcy that cost the British taxpayer billions.

Friday, August 17, 2012

The mis-selling of higher education

By Fraser Nelson

The Telegraph, August 16, 2012: To listen to ministers talk about university education, it is as if Britain has entered an academic arms race with the rest of the world. China’s universities, we’re told, are spewing out six million graduates a year: we must compete, or we’re doomed. In the Blair years, a national target was set: half of all young people ought to enter higher education. They’d have to get into debt, but they were reassured it would be a worthwhile investment. Having some letters after your name meant going further in your careers and earning far more. Those without a degree, by implication, would enter the workplace at a distinct disadvantage.

It is surprising that David Willetts should continue this line of argument, because he is clever enough to know what simplistic nonsense it is. It is understandable for the Universities Minister to be in favour of studying, but the real picture of education in Britain is far more complex. The idea of a binary divide in the career prospects of graduates and non-graduates is not a picture that would be recognised by employers. In many lines of work, those who did not get the A-levels for university now have a future just as bright (or otherwise) as the graduates.

From the moment that John Major started to abolish student grants, the British government has been in the business of selling (rather than simply providing) higher education. Yes, studying costs, runs the argument, but it is an investment: what students pay is a small fraction of what they will get back.
Then came the proliferation of courses and institutions, from BA (Hons) in Golf Management at the University of the Highlands and Islands to Trade Union Studies at Blackpool College. The definition of a degree has changed massively, but the financial argument used for getting one has not changed at all.

When Mr Willetts trebled the cap on university fees, he justified this by arguing that a university degree will “on average boost your earnings by £100,000 over a lifetime”. If true, that would – more or less – justify the average £40,000 of debt which is expected to face those who start college this autumn. But it doesn’t take a A* in A-level maths to suspect that the £100,000 figure disguises a vast range of alternative scenarios, many of which imply disadvantage for those who, for whatever reason, give university a miss.

Last year the Government released a research paper that spelt it out. For doctors and dentists, a degree is a prerequisite. They will earn £400,000 more over a lifetime, as you might expect, having been fully trained for a well-paid profession. But for students admitted to less rigorous degrees, the premium quickly diminishes – especially for men. Those who graduate in the subjects I studied, history and philosophy, can expect to earn a paltry £35 a year more than non-graduates. For graduates in “mass communication” the premium is just £120 a year. But both are better value than a degree in “creative arts”, where graduates can actually expect to earn £15,000 less, over a lifetime, than those who start work aged 18.

Read more

Monday, August 13, 2012

People Liberals Love to Hate, No. 29: Nationalists


Everyone loves to hate, even a liberal.

Believing that hate itself to be morally repugnant, a liberal can hate only those whose beliefs are morally repugnant.

Fortunately, that is not a problem, since to a liberal, whatever is not liberal is, by definition, morally repugnant.

Among those whom the liberal most loves to hate is the nationalist, for a nationalist is, to a liberal,self-evidently a racist, and a racist is for all practical purposes a white supremacist, and a white supremacist is in effect a Nazi, and a Nazi is the most hateful creature that ever walked this earth.

Thus it is that a liberal can view a nationalist with the orgasmic hatred of a Nazi contemplating a Jew.

Remarkably, this puts the the Zionist Jew, the Prime Minister of England, the Deputy Prime Minister of England and all the other openly avowed gentile supporters of Israel in the same camp as the Nazis, since all are advocates of what is perhaps the world's most virulent nationalism.

Also in the Nazi camp, according to the liberal view of nationalism, are Canada's 600 plus first nations who strive to perpetuate their national identity and racial heritage, revive their cultural tradition, and regain control of their ancestral lands.

Which suggests that there is something genocidal, hateful even, about the liberal view of nationalism.

Sunday, August 12, 2012

Obama Ignores Judge and Law in Asserting Tyrannical Power

What makes our NDAA lawsuit a struggle to save the US constitution

By Tangerine Bolen

Tangerine Bolen
Activist and reporter Tangerine Bolen, a plaintiff in the case against the NDAA, speaking to the media after a New York judge enjoined section 2012 of the law. Photograph via Fromthetrenchesworldreport
The Guardian, August 10, 2012: I am one of the lead plaintiffs in the civil lawsuit against the National Defense Authorization Act, which gives the president the power to hold any US citizen anywhere for as long as he wants, without charge or trial.

In a May hearing, Judge Katherine Forrest issued an injunction against it; this week, in a final hearing in New York City, US government lawyers asserted even more extreme powers – the right to disregard entirely the judge and the law. On Monday 6 August, Obama's lawyers filed an appeal to the injunction – a profoundly important development that, as of this writing, has been scarcely reported.

In the earlier March hearing, US government lawyers had confirmed that, yes, the NDAA does give the president the power to lock up people like journalist Chris Hedges and peaceful activists like myself and other plaintiffs. Government attorneys stated on record that even war correspondents could be locked up indefinitely under the NDAA.

Judge Forrest had ruled for a temporary injunction against an unconstitutional provision in this law, after government attorneys refused to provide assurances to the court that plaintiffs and others would not be indefinitely detained for engaging in first amendment activities. At that time, twice the government has refused to define what it means to be an "associated force", and it claimed the right to refrain from offering any clear definition of this term, or clear boundaries of power under this law.
This past week's hearing was even more terrifying. Government attorneys again, in this hearing, presented no evidence to support their position and brought forth no witnesses. Most incredibly, Obama's attorneys refused to assure the court, when questioned, that the NDAA's section 1021 – the provision that permits reporters and others who have not committed crimes to be detained without trial – has not been applied by the US government anywhere in the world after Judge Forrest's injunction. In other words, they were telling a US federal judge that they could not, or would not, state whether Obama's government had complied with the legal injunction that she had laid down before them.
To this, Judge Forrest responded that if the provision had indeed been applied, the United States government would be in contempt of court.

Friday, August 10, 2012

Lawsuit: US Department of Homeland Security Run by Perverts. Who'd Have Thought It

New York Daily News, August 9, 2012: Looks like the Department of Homeland Security could be renamed the Department of Hyper Sexuality.

A blistering federal discrimination suit accuses agency honcho Janet Napolitano of turning the department into a female-run “frat house” where male staffers were banished to the bathrooms and routinely humiliated.

James Hayes Jr., who now is New York’s top Homeland Security cop, claims Napolitano filled top spots in Washington, D.C., with two of her gal pals who were bent on tormenting male employees.

The suit identified them as Dora Schriro, who is now running the city Department of Correction, and Suzanne Barr, the chief of staff for the U.S. Immigration and Customs Enforcement.

Soon after Schriro and Barr were hired in January 2009, male staffers were treated like lapdogs, Hayes claims.

Barr “moved the entire contents of the offices of three employees, including name plates, computers and telephones, to the men’s bathroom at ICE headquarters,” the suit says.

Barr also stole a male staffer’s BlackBerry and fired off a message to his female supervisor indicating that he “had a crush on [her] and fantasized about her,” Hayes claims.

Sometimes, Barr took a more direct approach. In one case, she called a male colleague in his hotel room and screamed at him using sexually humiliating language, the suit says.

Hayes claims that after he reported the abuse to the Equal Employment Opportunity office, Napolitano launched a series of misconduct investigations against him.

Hayes claims he was denied a prized promotion and systematically pushed aside while working out of ICE’s Washington office. The suit says Schriro was named the special adviser to Secretary Napolitano on Detention and Removal Operations and began to replace Hayes at meetings despite having no “experience in managing a federal law enforcement department.”

Schriro did, however, have a “long standing relationship with [Napolitano],” the suit says.

Hayes, who is seeking relief for $335,000 in damages, was named the special agent in charge of ICE’s New York field office in Oct. 2009.

ICE Director of Public Affairs Brian Hale blasted the suit, which was filed in May and first reported by the blog, debbieschlussel.com.

“ICE doesn’t comment on unfounded claims and will respond to Mr. Hayes’ allegations as appropriate through the judicial system,” he said.

A Department of Correction spokesman denied claims that her relationship with Napolitano figured into her hiring.

“Commissioner Schriro’s selection and service at DHS was based on the merits. Any suggestion to the contrary is false,” spokesman Robin Campbell said.

Wednesday, August 8, 2012

The Chinese: A lot like Americans used to be

A123 Goes Chinese 

By Bob Lutz

Forbes Magazine, August 8, 2012: A Chinese auto parts company, Wanxiang, has come to the rescue of cash-strapped A123 Systems, an American high-tech lithium-ion battery maker and centerpiece of the Obama administration’s “green jobs” revolution. Wanxiang can acquire up to an 80% of the company in return for an investment of up to $450 million.

The recipient of a $249 million “green technology” grant from our federal government, A123, believing their own (and everyone else’s) hype about the millions of electric vehicles that would soon be filling the nation’s highways (it will happen, but not soon) set about proving an old adage: stupidity and waste increase with the amount of money available. Production capacity was set at a level that was way overly optimistic, and the headquarters complex, with its magnificent office suites and marbled lobbies, was something only a company with tons of money would dream of. But I’m sure the risk seemed low: After all, the “green revolution” was upon us. Even Nancy Pelosi said it was so!
But, as always in this vexing, over-regulated, over-taxed but still-twitching private enterprise system of ours, the marketplace overwhelmingly voted for the speed, range and lower price of conventional cars, even at $4 per gallon. It’s another example of a government-directed “green jobs” initiative which, while environmentally praiseworthy (especially if you believe in manmade global warming), was economically idiotic: when capital is spent on a product for which there is insufficient demand, negative economic value is created and jobs, green or otherwise, are lost. To make matters worse, not only is the capital lost, but, had it not been squandered on green “hope and change,” that same capital could have been spent productively, creating something that the public actually wants and needs.

That’s the real crime of the “green jobs” initiative: it destroys capital that is so badly needed elsewhere to revitalize our economy.

Read more

The intolerance of liberals. No. 79

Olympic Political Correctness
Who will win the racial-sensitivity gold medal?
By John Fund

Greek triple-jump champion Voula Papachristou

National Review Online, August 7, 2012: The London Olympics features 302 events. But this year there clearly is a new category: racial sensitivity. These Olympic Games are rife with examples of people taking offense, and it’s time to discuss some guardrails and guidelines before political correctness takes over completely.

First, some behavior on the part of athletes is clearly out of bounds. After Swiss footballer Michel Morganella’s team lost to South Korea, he said on Twitter that his opponents could “go burn” and were a “bunch of mongoloids.” That’s hardly sporting behavior, and he was sent home for insulting the dignity of the Korean team. Beyond that, it was just offensive speech.

And sometimes it’s the critics who are clearly out of line. NBC was deluged with criticism because it ran an ad that offended fans of gold-medal-winning U.S. gymnast Gabby Douglas, who is black. NBC commentator Bob Costas had just finished a commentary in which he said that “much of America has fallen in love with Gabby Douglas” when a gymnastics-themed commercial appeared promoting NBC’s comedy Animal Practice. It featured a small, grinning monkey doing gymnastic tricks.

Because African Americans have sometimes been compared to simians by people trying to dehumanize them, many viewers complained the ad was racist. NBC responded with an apology and an explanation that the ad was placed in the lineup of commercials long before Douglas won her medal. That should end that story.

Saturday, August 4, 2012

How Canada Opted for Libertarian Socialism

By William Gairdner

williamgairdner.com, March 28, 2012: 

This is an excerpt from Chapter One of The Trouble With Canada ... Still! (BPS Books, 2011)

        As it happened, in his very person Trudeau embodied the French and English styles described above, for he had a French-Canadian father, and a Scottish mother. Canadian scholars burn a lot of energy debating whether Trudeau was a “socialist” or a “libertarian” and assume the two things are contradictory. For he famously said that “the state has no place in the bedrooms of the nation.” But he also entrenched coast-to-coast radical equalization policies in his Charter. Here was a man very comfortable with multiple mistresses, with legislating homosexual rights, and who, even as Prime Minister did not mind taking off his clothes and sunbathing nude in mixed company.[1] He was a flamboyant libertarian who imposed the most controlling and expensive Statist regime on Canada in its history.

         So was he a socialist or a libertarian?

         My answer:  he was a “libertarian socialist,” and we Canadians all now live under his libertarian socialists regime. But how? How can this circle be squared? These things are opposites, aren’t they? Not really. It’s just the two labels are applied to different things. Think of what is individual, private, and physical: your body. Then think of what is public and general: a service like health care, or education, or a language right. Trudeau’s Charter combined and enabled these two conflicting styles by encouraging the separation of the private body, from the public body.  He was a libertarian in that he believed matters of the private body are no one else’s business. But when it came to goods he felt we all deserve from the State? Why, then a powerful system for providing, equalizing, and controlling access to such goods must be set up, and this would be done through taxation and fiscal bribery of the provinces; that is, through shared-cost programs or grants financed by exorbitant levels of individual taxation and unconscionable borrowing.  But what kind of socialism was it? What kind of libertarianism?   
    
His Socialist Conviction

             Trudeau was trying, as mentioned, to spin the wheel slowly, so that without realizing the change of direction, a Canadian would find himself “disembarking at a different island than the one he thought he was sailing for.” Fundamentally, on the public level, all that he did was clearly and resolutely substitute the French-Statist style for the English-Liberty style at every opportunity. By the time he was finished, Canada had changed from a fiscally stable, low-debt, reasonably free, only mildly-socialized nation under limited government, to one bending under huge public debt, highly managerial, and much more thoroughly socialist in its fiscal and social commitments. In his first and only major book, Federalism and the French Canadians, Trudeau clearly outlined this plan for Canada. At the time, most leftists argued that socialism could not successfully be planted in a nation such as ours with an existing federal system because the powers of governance in such nations are already divided as between central and local jurisdictions, and this division of powers is entrenched forever in their constitutions. So the general conclusion was that Canada was not and never would be a candidate for socialism. But Trudeau disagreed. He spoke admiringly of "that superb strategist, Mao Tse-Tung" who argued that “planting socialism” in various regional strongholds was "the very best thing." Accordingly, Trudeau developed the argument that systems such as Canada’s, contrary to the advice of all the theorists, can indeed be made socialist, and that our British-style federal system "must be welcomed as a valuable tool which permits dynamic parties to plant socialist governments in certain provinces, from which the seeds of radicalism can slowly spread"[2]

 His Libertarian Conviction

                 Trudeau probably wrote as much about individual rights as about socialism, and most scholars, and the public in general continue to believe these two political philosophies are in clear contradiction. Certainly, in their party platforms, socialists and libertarians are sworn enemies. But as mentioned, Trudeau’s genius was to combine these contraries by splitting their domains between what is inside our skin, and what is outside it: private body, and public body; person and polis.  

        He was throwing the Canadian people a bone by reducing the larger realm of freedom to which they had been accustomed, to their persons and bodies. But all the “public” freedoms having to do with economics and trade, private property, education, provision of health care, welfare, and so on, would fall under Statist regulation. He knew that if he could leave us unfettered and free with respect to most of our personal bodily pleasures, we would be fooled into believing we were still free in all our former ways. But those were precisely the freedoms he despised: the bottom-up political, economic, and legislative realities essential to the creation of the British-style that produced what he called scornfully, our "checkerboard federalism." To him, Canada’s parliamentarians were “just nobodies,” and “a crummy lot” (this, he uttered publicly in 1969).  The British Style was a reality that stood in the way of his French-style plan for Statism. So the system had to be changed. Trudeau was Canada’s Procrustes, doing his utmost to make a one-size-fits-all political bed for Canadian citizens.  

          His libertarian ethic, which is based on the idea that liberty means doing whatever you want as long as you don’t harm anyone else, was absorbed from typical English individualist thinking that was radicalized by John Stuart Mill in his canonical booklet, On Liberty (1859). It is called Mill’s “Harm Principle,” and it neatly articulated Mill’s simplistic argument for the privatization of morality that it has by now become the standard reasoning in defence of personal moral autonomy all over the Western world. Prior to Mill, throughout our long Judeo-Christian tradition, morality – codes of right and wrong behavior - had always been considered a community good. Moral standards reflected common religious and community standards. The metaphor was that we all live under a common moral bubble wherein by means of conviction, belief, and debate we sustain a common set of shalls and shall-nots that defines us morally … who we are.  Mill argued instead that we each ought to live under our own private self-defined moral bubble, and be concerned for others only if we bump into them. Then we just apologize, or negotiate a solution to any harm done.

         Mill failed to see that if you are completely alone in the universe it is true that you can do whatever you want, and call it “morality” if you like. But because there are no other human beings in existence and you cannot therefore help or harm anyone else, you can also call it Winnie-the-Pooh. However, as soon as someone else exists in addition to yourself, you must take into consideration whether your actions will help them, or harm them, now, or in the future, directly or indirectly. Suddenly, what was a personal and private act, becomes public, and thus falls under the term “morality,” rightly considered. In his person and in his politics, Trudeau combined two conflicting styles: the personal libertarianism articulated by Mill, and the Statism of Rousseau.

The intolerance of liberals

By Chris Kempling Psy.D., R.C.C.

Narth.com: The raging public debate over same sex marriages in Canada, and now Massachusetts, has highlighted the great divide between those who are socially liberal, and those who are socially conservative.

Generally speaking, the socially liberal are found on the center-left of the political spectrum, and include labor unions, women's and gay rights organizations, human-rights tribunals, much of the popular media, a good proportion of the "intelligentsia"," and, it may be argued, the judiciary.

Social conservatives tend to occupy the political right, and may be found in large numbers among those who adhere to organized religions, and many immigrant cultural groups. The socially liberal appear to be in the ascendancy and have been remarkably successful in achieving many of their goals to "modernize" culture and society. Social conservatives decry such "progress," seeing instead a degradation of moral behavior and standards of social conduct.

A very thoughtful analysis of why this great divide exists is contained in an article entitled "Sexual Morality: The cultures and emotions of conservatives and liberals," published in the Journal of Applied Social Psychology (Haidt and Hersh, 2001). Haidt and Hersh argue that, in the area of sexual conduct, social liberals operate within a narrow moral framework which they call the "ethics of autonomy" (EOA). The ethics of autonomy hold that only acts that cause harm to self or others should be condemned. Acts which are consensual and are perceived not to cause harm should be tolerated or even affirmed.

Under EOA, rationalization for approval of various non-traditional sexual behaviors is justified under the concept of the right of individuals to behave autonomously, acting according to their own conscience, rather than a higher authority.

It can be argued that EOA is foundational to the arguments social liberals make for re-defining what types of sexual behaviors and relationships are acceptable in today's society. Thus, when people say that there is nothing wrong with allowing homosexuals to marry, or that homosexuality should be taught as a normal variant in public school sex education classes, or that adult-child sex is not really harmful and should be permitted, they are using the ethics of autonomy as the philosophical base for their position. The EOA recently prevailed in the US when the Supreme Court struck down the anti-sodomy laws of Texas. Pierre Trudeau's decision in 1968 to remove homosexual acts from the criminal code, because "the state has no business in the bedrooms of the nations," was also an EOA-based decision.

Social conservatives operate on a much broader moral plain. Haidt and Hersh posit that social conservatives base their attitudes of what is morally acceptable on two additional sets of ethics: the ethics of community (EOC) and the ethics of divinity (EOD). The ethics of community are concerned with duty, perceived social roles, traditions, mutual respect, and what is appropriate for maintaining social order and family life. EOC is found in such organizations as Focus on the Family, REAL Women and the Canadian Alliance for Social Justice and Family Values. The latter organization is almost entirely made up of Chinese Canadians. Middle Eastern and South Asian cultural groups (religiously Muslims, Sikhs and Hindus) would also ascribe to EOC values.

People holding to EOC values are genuinely concerned about the decay of family and societal values, and perceive that those who ascribe to EOA values rank hedonism, the pursuit of pleasure, as more important than maintaining the social fabric.

The ethics of divinity (EOD) are concerned with the sacred, purity, and with living a life consistent with the requirements of God, generally as revealed in sacred scriptures. Those who ascribe to EOD believe in a universal moral order, ordained by God, and that to depart from it risks eternal separation from the divine in the life to come. All the world's great religions hold to these beliefs. Thus, in the area of sexual morality, EOD believers have behavioral standards much more restricted than those who hold to EOA beliefs. This is why when EOD people write publicly, they often tend to cite holy scripture as the justification for their concerns. The reaction from those in the EOA camp is often dismissive, because they generally do not subscribe to the concept of accountability to a divinely ordained universal moral code.

Heidt and Hersh found in their research, not surprisingly, that study participants from conservative church groups were much more likely to use EOD than EOA in their assessment of what types of sexual behaviors were acceptable. Atheists and the non-religious tended to use EOA in their assessments, and consequently were more accepting of non-traditional sexual behaviors.
There has been a growing tendency among those in the EOA camp to accuse those in the EOC/EOD camp of "homophobia" if they dare to speak or write publicly about their concerns. Indeed several Christians have been successfully prosecuted by gay activists in the courts and human rights tribunals for publicly expressing their opposition to homosexual behavior. Moral disapproval for certain sexual behaviors based on EOC/EOD positions ought not to be defined as an irrational or phobic reaction, however. Yet that is the sledgehammer those in the EOA camp have been employing with considerable success in the past decade. Currently, there is general acceptance of the term homophobia, and general agreement that it is a negative influence in public life.

To this end, there is a concerted effort by gay and lesbian lobby groups, and supported by teachers' unions, to implement anti-homophobia and anti-heterosexism programming in Canadian public schools. Regrettably, there has been very little attempt to accommodate the concerns of the EOC/EOD side, resulting in divisive and expensive court battles, most notably the Trinity Western University and Surrey Book cases.

Those who hold EOC/EOD positions are not prepared to compromise their religious beliefs or cultural values to accept as normative, sexual behaviors condemned by tradition or holy writ. It is necessary for those in the EOA camp to understand that EOC/EOD believers may be homo-negative towards certain sexual behaviors, but homo-positive in affirming the inherent worth of homosexual persons. This position is affirmed by all responsible religiously based social conservative organizations, but seen as unacceptable by leaders of the EOA camp. They argue that sexual orientation and the accompanying behaviors are inextricably linked, and that to condemn the behaviors is the same as condemning the person.

The EOA position that sexual orientation is inherent and unchangeable is simply not supported by social science research. Indeed, even the psychiatrist most responsible for the removal of homosexuality from manual of mental disorders (the DSM) in 1973, Dr. Robert Spitzer, has published research affirming that orientation change therapy has been shown to be beneficial and effective for the majority of his study group (Can Some Gay Men and Lesbians Change Their Sexual Orientation? 200 Participants Reporting a Change from Homosexual to Heterosexual Orientation, Archives of Sexual Behavior, October 2003, 403-417). The majority of his group were motivated by desires to marry, to maintain their marriage, or to live a life consistent with their religious beliefs.

To that end, most major religious groups in North America have established therapeutic resources for those in their faith communities who are distressed over unwanted same sex attractions, and who are motivated to re-orient towards heterosexuality. For Jews there is JONAH, Mormons have Evergreen, Catholics call theirs Courage, and Protestants have Exodus.

These organizations (including NARTH) exist because those with unwanted same-sex attractions have asked for help for dealing with their distressing symptoms. The treatment category in the DSM IV is 302.9(3) "persistent and marked distress over one's orientation." Ironically, it is a denial of the concept of autonomy for those in the EOA camp to try to prevent these people from gaining access to these types of services. Gay and lesbian lobby groups have vigorously (but unsuccessfully) lobbied the American Psychological Association to declare orientation change therapy unethical. The personal stories of those who have undergone re-orientation therapy successfully are posted at www.peoplecanchange.com.

Mandatory indoctrination of all public school children with EOA ideology in the area of sexual behavior, is profoundly disrespectful and manifestly unethical, as it violates the rights of EOC/EOD parents to transmit their values to their children. The United Nations has repeatedly affirmed that this is an inalienable right of parents. Educational authorities have delegated roles in the education of children, and do not have the right to impose an EOA value system without parental consent. Furthermore, such efforts violate the specific requirements of the BC Teachers Federation code of ethics to respect the sensibilities of their students, and to refrain from using their roles for ideological gain.

We live in a pluralistic society where a broad spectrum of values is cherished. It is the duty of public educators to acknowledge all three ethical positions. Denigrating those who adhere to ethics of community or ethics of divinity is no way to achieve social harmony, or even improved social conditions for sexual minorities. Let us agree on what we can agree on: affirmation of the inherent worth of everyone, non violence, eradication of harassment, bullying and name-calling, and promoting understanding of each other's profoundly held values. Against this ethic, there can be no argument.

Chris Kempling is a Registered Clinical Counselor and NARTH member living in Quesnel, BC Canada. Feedback at Kempling@telus.net is welcome.

Pierre Elliot Trudeau: Apologist for Totalitarianism

By George Jonas

National Post, via JeanChretien.Libertyca.net, October 16, 2000: When Pierre Elliott Trudeau died last month, many Canadians, even among those who recognized the flaws in his legacy -- his support of Soviet tyranny, his taste for command economics, and the deep fissures created by his multiculturalism -- nevertheless suspended judgment as the nation indulged in a reprise of Trudeaumania. Here, George Jonas argues that while Trudeau's charm and charisma are gone, his execrable ideas and institutions live on.

Like a flashback from a bad LSD trip, Canada has been in the grip of Trudeaumania. One standard dictionary defines "mania" as an "obsessional enthusiasm." This is at best. The primary definition is "a mental disorder characterized by great excitement." Perhaps Trudeaumania fit the kinder definition in 1967, but 33 years later it can only be defined in the primary sense. In the year 2000, obsessive partiality to Mr. Trudeau's legacy presupposes either ignorance of what his legacy is, or a mental disorder.

Mr. Trudeau walked among us between 1919 and 2000. He concerned himself with public affairs during the 55 years spanning 1942 and 1997, first as a student and journalist, then as a politician and national leader, and finally as an elder statesman. During those years, the first main domestic argument in Canada was between free enterprise and the interventionist economy, and the second between the unitary and the devolutionary state. Internationally, the main argument was between liberal democracy and totalitarianism. [emphasis added]

It's safe to say that in the first and the third of these arguments, Mr. Trudeau took the wrong side. The jury is still out on the second.

Some would argue Mr. Trudeau didn't take the wrong side between liberal democracy and totalitarianism, only the middle ground. This is silly. One cannot take the middle ground between life and death. If one proposes to conduct electricity, declaring neutrality between brass and rubber won't do. Mr. Trudeau did make a choice, and -- to stick with the same metaphor -- he chose rubber. Domestically, he favoured the command economy over free enterprise, and the unitary state over devolution. Internationally, he sided with Marxism-Leninism over liberal democracy. No wonder the lights failed to go on.

The wonder is that many of the same people who wouldn't see eye to eye with Mr. Trudeau on minimally two of the three fundamental questions that confronted him during his stewardship of Canada -- i.e. people who take the failure of Communism and the command economy for granted -- still grew misty-eyed at his passing, and spent the past two weeks extolling his legacy in near-hysterical terms.

David Frum (whose piece in The Wall Street Journal was titled "A Great Man, but a Catastrophic Prime Minister"), writing in this paper, helped to dispel one particularly misleading myth about Mr. Trudeau with his accurate description of Canada's Charter of Rights and Freedoms as "the opposite of a liberty-enhancing document." Though initially even the National Post joined the chorus of weeping and wailing, by Oct. 7, in an editorial titled "His communist pals," the paper put Mr. Trudeau's relationship with totalitarianism squarely on record. Some journalists refrained from writing about Mr. Trudeau for days after his death, because (as the columnist Michael Coren put it) "I thought it fit that he was buried before comment." Seemly as such reticence was, it allowed a deluge of appalling nonsense to inundate the media virtually unchallenged for the first number of days.

Mr. Trudeau was cut of the same cloth. He was bright, had an acid tongue and didn't suffer fools gladly. This might have been fine, except he regarded everyone who disagreed with him as a fool. Such leaders run the risk of surrounding themselves mainly with groupies, sycophants and nonentities. Mr. Trudeau was no exception. As Mr. Fulford wrote, his cabinet eventually "turned into a collection of mediocrities."

Read more

Friday, August 3, 2012

Race and IQ: Are Comparisons Intelligent?

So-called intelligence tests measure speed and accuracy in the performance of certain intellectual tasks tackled in particular ways. The idea that intelligence so measured is genetically fixed and can thus be used to differentiate among human populations or races was conclusively repudiated by James R. Flynn who found that over the last 60 years, in all countries for which data exist, intelligence test scores have shown a generational increase of from 5 to 25 points on a standard IQ test, or an average of one standard deviation.

The measured mental capacities that psychologists call intelligence must, therefore, be strongly influenced by environment. That this is so is hardly surprising. The brain is a highly plastic organ. Mozart was a genius, but without a father, himself an accomplished composer, determined to create a prodigy, Mozart's innate musical gifts would likely never have been made manifest. Raised on an 18th century Irish potato farm, Mozart would more probably have been regarded as an an idiot than an idiot savant.

In a review of the large body of data on population differences in IQ assembled by Lyn and Vanhanen in their 2001 treatise IQ and the Wealth of Nations, Ron Unz offers a plausible interpretation of the Flynn effect:
... There has been considerable speculation that this general rise in IQ-test performance is based on the increasingly complex and technological environment surrounding us, whose intricacies constantly train all of us in the sort of mental abstractions found in most IQ tests, thereby gradually raising our test scores without necessarily raising our intelligence. In effect, life in modern urban societies has become a daily cram-course for IQ tests. ...
The huge impact of social environment on  IQ that the Flynn effect reveals and the well-established relationship between IQ and wealth goes a long way toward explaining the stability of social class or racial stratification within societies. High IQ promotes economic success, economic success creates an environment conducive to the development of high IQ.  Thus a tiny elite can achieve long-lasting preeminence, while entire social or racial groups are largely denied social advancement by virtue of the constraints on intellectual development that poverty imposes.

The corollary to this conclusion is that for the disadvantaged in society to advance materially or socially it is necessary that they adopt some features of the lifestyle of those more privileged than themselves. Which means that those who blame the poverty or delinquency of the disadvantaged on society's unfairness or racism, rather than on the failure of many who are poor to strive to become what they presently are not, only help perpetuate existing class divisions.

That, surely,  is why the elites of Western nations maintain a hugely expensive educational/propaganda system that inculcates a whinging self-pitying mentality among the masses, thereby ensuring a comfortable absence of competition for wealth and power. It would also explain why old-fashioned ideas of self help through self-discipline driven by ambition are almost universally despised in the so-called liberal democracies.

But merely because socio-economic factors can be important in determining certain measures of intelligence or social success, it would be absurd to assume that genetics has no role in determining intellectual differences among individuals and groups. The structure and functioning of the mammalian brain, the most complex thing in the universe, has many genetic determinants, variation among which must contribute to the uniqueness of individuals and the distinctness of races.

An interesting racial distinction to which Ron Unz draws attention is the apparent immunity of Southeast Asians to an effect of wealth on IQ. In part, the explanation may be found in the relative conservatism of Southeast Asians, which inculcates a more or less universal drive for self-advancement through discipline and hard work, thus ensuring that individuals, irrespective of wealth, are more likely to develop whatever intellectual capacities they possess than is the case among the lower strata in other societies.

See also,
CanSpeccy: Race and IQ in America

Thursday, August 2, 2012

Pathologies of Our Peculiar Age


Taki's Mag, August 02, 2012

The USA, I’m sorry to see, is currently behind China in gold medals, 17-12.

And oh dear, there’s Britain, with only two gold medals.

It’s only Wednesday night, though—end of the fifth day, eleven still to go. I’m sure the old country will perk up and gather a few more golds. It can’t possibly be the case, as that dire opening ceremony seemed to suggest, that the entire national genius of the British is now concentrated on running hospitals, recycling old pop songs, writing whimsical stories for children, performing the national anthem in sign language, and celebrating diversity.

Or as Peter Hitchens said in a wonderfully peppery Daily Mail column:
It is a strange sort of nation that can turn a hospital bed into a symbol of national pride, especially in an era when you can die of thirst in one.
Yes, I’m trying to keep up with the Olympics. This goes against my general inclinations.

For one thing, there’s the totalitarian angle. A huge organized sporting event like this, with its son et lumière opening spectacle, hundreds of flags paraded around to the cheers of the multitude, and strong social pressure on us all to show enthusiastic approval, inevitably brings to mind the great 20th-century despotic utopias. Does the name Leni Riefenstahl mean anything?

As I blogged three Olympics ago (how time flies!):
The reason that fascists and communists love sport is, of course, that sport has no linguistic content. Totalitarians hate language and wage constant war against it — another thing Orwell taught us. Sport is therefore the ideal lowbrow entertainment from the point of view of jealous power elites, just as ballet is the ideal highbrow entertainment. The old Soviet Union poured huge resources into both.
The main venue for this year’s Olympics is in London’s East End, not far from the hyper-gentrified Isle of Dogs, where my wife and I owned a pleasant little apartment twenty-something years ago. We bought at the top of the market and sold at the bottom, for £100,000 each time. Now the damn thing is worth half a million at least. This rankles. I’d rather not be reminded. (Should I ever offer you advice about real-estate investment, run like the wind!)

The Games are like a great lens, magnifying all the pathologies of our peculiar age. The opening ceremony was one long, monstrous illustration of this truth, pathology after pathology paraded before us as if old London was a beggar displaying his sores: stagnant popular culture, progressivism’s bogus iconography, rampant “diversity,” and a kind of valetudinarian supremacy forcing our attention toward the sick and disabled even at a festival of health and strength.

Poor Muhammad Ali, who though only one of the nine bearers of the Olympic flag—and perforce a token one at that, given his sad condition—was in a way the perfect emblem of what the opening ceremony was striving for: Black! Muslim! Pacifist! Disabled!

So no, I’m not much of an Olympics fan. And yet I watch and check the medal tables.

For all the globalist twaddle, for all the PC triumphalism, for all the gross waste of public funds, for all the North Korean-style massed choirs and dance troupes (which must have been an inspiration to the actual Norks: they have four gold medals, which is more than Germany, Great Britain, and Russia have)—for all that, the Olympics are still one place where nations compare themselves with each other.

Diversify us all you like. Shower us with multicultural imagery. Open our borders to all the world’s wanderers. Teach our children to hate their ancestors and despise their own race. Make us press “2” for our own language. Still, nine out of ten people watching the Olympics, even in the terminally decadent West, are rooting for their nation (though not necessarily for the nation of their current domicile).

Well, well, no doubt we shall soon be One World, blending together in multicultural harmony. Then the true Olympic spirit will prevail: not nation against nation, only athlete against athlete.
By that time, though, as Randall Parker has speculated, the Olympic Games may be redundant:
Since super athletes have genes that make them far more able to compete some argue that sporting competitions are just elaborate games aimed at identifying who has the best genetic sequences. Great sporting competitions, whether professional or amateur, end up turning into elaborate mechanisms for filtering for the most genetically well endowed. Falling genetic sequencing costs promise to take away the need for sporting competitions for this purpose.
Then we shall be able to dispense with the events and the spectacle altogether, awarding the men’s 200-meter butterfly gold to whomever has nucleotide sequence CCTAAACTCAGTGTGGCCCTGGCCCTGTGACATGCTGGCGATGCAGTCCC at the proper locus on chromosome 12.

Hey, it’ll be cheaper.

Race and IQ: Are Comparisons Intelligent?

Canspeccy.wordpress.com, August 2, 2012:So-called intelligence tests measure speed and accuracy in the performance of certain intellectual tasks tackled in particular ways. The idea that intelligence so measured is genetically fixed and can thus be used to differentiate among human populations or races was conclusively repudiated by James R. Flynn who found that over the last 60 years, in all countries for which data exist, intelligence test scores have shown a generational increase of from 5 to 25 points on a standard IQ test, or an average of one standard deviation.

The measured mental capacities that psychologists call intelligence must, therefore, be strongly influenced by environment. That this is so is hardly surprising. The brain is a highly plastic organ. Mozart was a genius, but without a father, himself an accomplished composer, determined to create a prodigy, Mozart’s innate musical gifts would likely never have been made manifest. Raised on an 18th century Irish potato farm, Mozart would more probably have been regarded as an an idiot than an idiot savant.

In a review of the large body of data on population differences in IQ assembled by Lyn and Vanhanen in their 2001 treatise IQ and the Wealth of Nations, Ron Unz offers a plausible interpretation of the Flynn effect:
… There has been considerable speculation that this general rise in IQ-test performance is based on the increasingly complex and technological environment surrounding us, whose intricacies constantly train all of us in the sort of mental abstractions found in most IQ tests, thereby gradually raising our test scores without necessarily raising our intelligence. In effect, life in modern urban societies has become a daily cram-course for IQ tests. …
The huge impact of social environment on IQ that the Flynn effect reveals and the well-established relationship between IQ and wealth goes a long way toward explaining the stability of social class or racial stratification within societies. High IQ promotes economic success, economic success creates an environment conducive to the development of high IQ. Thus a tiny elite can achieve long-lasting preeminence, while entire social or racial groups are largely denied social advancement by virtue of the constraints on intellectual development that poverty imposes.

The corollary to this conclusion is that for the disadvantaged in society to advance materially or socially it is necessary that they adopt some features of the lifestyle of those more privileged than themselves. Which means that those who blame the poverty or delinquency of the disadvantaged on society’s unfairness or racism, rather than on the failure of many who are poor to strive to become what they presently are not, only help perpetuate existing class divisions.

That, surely, is why the elites of Western nations maintain a hugely expensive educational/propaganda system that inculcates a whinging self-pitying mentality among the masses, thereby ensuring a comfortable absence of competition for wealth and power. It would also explain why old-fashioned ideas of self help through self-discipline driven by ambition are almost universally despised in the so-called liberal democracies.

But merely because socio-economic factors can be important in determining certain measures of intelligence or social success, it would be absurd to assume that genetics has no role in determining intellectual differences among individuals and groups. The structure and functioning of the mammalian brain, the most complex thing in the universe, has many genetic determinants, variation among which must contribute to the uniqueness of individuals and the distinctness of races.

An interesting racial distinction to which Ron Unz draws attention is the apparent immunity of Southeast Asians to an effect of wealth on IQ. In part, the explanation may be found in the relative conservatism of Southeast Asians, which inculcates a more or less universal drive for self-advancement through discipline and hard work, thus ensuring that individuals, irrespective of wealth, are more likely to develop whatever intellectual capacities they possess than is the case among the lower strata in other societies.