Thursday, August 2, 2012

Pathologies of Our Peculiar Age


Taki's Mag, August 02, 2012

The USA, I’m sorry to see, is currently behind China in gold medals, 17-12.

And oh dear, there’s Britain, with only two gold medals.

It’s only Wednesday night, though—end of the fifth day, eleven still to go. I’m sure the old country will perk up and gather a few more golds. It can’t possibly be the case, as that dire opening ceremony seemed to suggest, that the entire national genius of the British is now concentrated on running hospitals, recycling old pop songs, writing whimsical stories for children, performing the national anthem in sign language, and celebrating diversity.

Or as Peter Hitchens said in a wonderfully peppery Daily Mail column:
It is a strange sort of nation that can turn a hospital bed into a symbol of national pride, especially in an era when you can die of thirst in one.
Yes, I’m trying to keep up with the Olympics. This goes against my general inclinations.

For one thing, there’s the totalitarian angle. A huge organized sporting event like this, with its son et lumière opening spectacle, hundreds of flags paraded around to the cheers of the multitude, and strong social pressure on us all to show enthusiastic approval, inevitably brings to mind the great 20th-century despotic utopias. Does the name Leni Riefenstahl mean anything?

As I blogged three Olympics ago (how time flies!):
The reason that fascists and communists love sport is, of course, that sport has no linguistic content. Totalitarians hate language and wage constant war against it — another thing Orwell taught us. Sport is therefore the ideal lowbrow entertainment from the point of view of jealous power elites, just as ballet is the ideal highbrow entertainment. The old Soviet Union poured huge resources into both.
The main venue for this year’s Olympics is in London’s East End, not far from the hyper-gentrified Isle of Dogs, where my wife and I owned a pleasant little apartment twenty-something years ago. We bought at the top of the market and sold at the bottom, for £100,000 each time. Now the damn thing is worth half a million at least. This rankles. I’d rather not be reminded. (Should I ever offer you advice about real-estate investment, run like the wind!)

The Games are like a great lens, magnifying all the pathologies of our peculiar age. The opening ceremony was one long, monstrous illustration of this truth, pathology after pathology paraded before us as if old London was a beggar displaying his sores: stagnant popular culture, progressivism’s bogus iconography, rampant “diversity,” and a kind of valetudinarian supremacy forcing our attention toward the sick and disabled even at a festival of health and strength.

Poor Muhammad Ali, who though only one of the nine bearers of the Olympic flag—and perforce a token one at that, given his sad condition—was in a way the perfect emblem of what the opening ceremony was striving for: Black! Muslim! Pacifist! Disabled!

So no, I’m not much of an Olympics fan. And yet I watch and check the medal tables.

For all the globalist twaddle, for all the PC triumphalism, for all the gross waste of public funds, for all the North Korean-style massed choirs and dance troupes (which must have been an inspiration to the actual Norks: they have four gold medals, which is more than Germany, Great Britain, and Russia have)—for all that, the Olympics are still one place where nations compare themselves with each other.

Diversify us all you like. Shower us with multicultural imagery. Open our borders to all the world’s wanderers. Teach our children to hate their ancestors and despise their own race. Make us press “2” for our own language. Still, nine out of ten people watching the Olympics, even in the terminally decadent West, are rooting for their nation (though not necessarily for the nation of their current domicile).

Well, well, no doubt we shall soon be One World, blending together in multicultural harmony. Then the true Olympic spirit will prevail: not nation against nation, only athlete against athlete.
By that time, though, as Randall Parker has speculated, the Olympic Games may be redundant:
Since super athletes have genes that make them far more able to compete some argue that sporting competitions are just elaborate games aimed at identifying who has the best genetic sequences. Great sporting competitions, whether professional or amateur, end up turning into elaborate mechanisms for filtering for the most genetically well endowed. Falling genetic sequencing costs promise to take away the need for sporting competitions for this purpose.
Then we shall be able to dispense with the events and the spectacle altogether, awarding the men’s 200-meter butterfly gold to whomever has nucleotide sequence CCTAAACTCAGTGTGGCCCTGGCCCTGTGACATGCTGGCGATGCAGTCCC at the proper locus on chromosome 12.

Hey, it’ll be cheaper.

Race and IQ: Are Comparisons Intelligent?

Canspeccy.wordpress.com, August 2, 2012:So-called intelligence tests measure speed and accuracy in the performance of certain intellectual tasks tackled in particular ways. The idea that intelligence so measured is genetically fixed and can thus be used to differentiate among human populations or races was conclusively repudiated by James R. Flynn who found that over the last 60 years, in all countries for which data exist, intelligence test scores have shown a generational increase of from 5 to 25 points on a standard IQ test, or an average of one standard deviation.

The measured mental capacities that psychologists call intelligence must, therefore, be strongly influenced by environment. That this is so is hardly surprising. The brain is a highly plastic organ. Mozart was a genius, but without a father, himself an accomplished composer, determined to create a prodigy, Mozart’s innate musical gifts would likely never have been made manifest. Raised on an 18th century Irish potato farm, Mozart would more probably have been regarded as an an idiot than an idiot savant.

In a review of the large body of data on population differences in IQ assembled by Lyn and Vanhanen in their 2001 treatise IQ and the Wealth of Nations, Ron Unz offers a plausible interpretation of the Flynn effect:
… There has been considerable speculation that this general rise in IQ-test performance is based on the increasingly complex and technological environment surrounding us, whose intricacies constantly train all of us in the sort of mental abstractions found in most IQ tests, thereby gradually raising our test scores without necessarily raising our intelligence. In effect, life in modern urban societies has become a daily cram-course for IQ tests. …
The huge impact of social environment on IQ that the Flynn effect reveals and the well-established relationship between IQ and wealth goes a long way toward explaining the stability of social class or racial stratification within societies. High IQ promotes economic success, economic success creates an environment conducive to the development of high IQ. Thus a tiny elite can achieve long-lasting preeminence, while entire social or racial groups are largely denied social advancement by virtue of the constraints on intellectual development that poverty imposes.

The corollary to this conclusion is that for the disadvantaged in society to advance materially or socially it is necessary that they adopt some features of the lifestyle of those more privileged than themselves. Which means that those who blame the poverty or delinquency of the disadvantaged on society’s unfairness or racism, rather than on the failure of many who are poor to strive to become what they presently are not, only help perpetuate existing class divisions.

That, surely, is why the elites of Western nations maintain a hugely expensive educational/propaganda system that inculcates a whinging self-pitying mentality among the masses, thereby ensuring a comfortable absence of competition for wealth and power. It would also explain why old-fashioned ideas of self help through self-discipline driven by ambition are almost universally despised in the so-called liberal democracies.

But merely because socio-economic factors can be important in determining certain measures of intelligence or social success, it would be absurd to assume that genetics has no role in determining intellectual differences among individuals and groups. The structure and functioning of the mammalian brain, the most complex thing in the universe, has many genetic determinants, variation among which must contribute to the uniqueness of individuals and the distinctness of races.

An interesting racial distinction to which Ron Unz draws attention is the apparent immunity of Southeast Asians to an effect of wealth on IQ. In part, the explanation may be found in the relative conservatism of Southeast Asians, which inculcates a more or less universal drive for self-advancement through discipline and hard work, thus ensuring that individuals, irrespective of wealth, are more likely to develop whatever intellectual capacities they possess than is the case among the lower strata in other societies.

Thursday, July 26, 2012

Why we're screwed. Or forget the economics, just follow the money

Because of the success of science, there [has emerged] a kind of pseudo-science. Social science is an example of a science that is not a science. They follow the forms, gather data, but they don't get any laws. The haven't found any yet. Maybe someday they will. [But] they are not scientific. They sit at a a typewriter and they make up something. Maybe true, maybe not true, but it has not been demonstrated.
Richard Feynman
Economics is a social science, and as Feynman implied, it is mostly bollocks.

The Australian economist, Steve Kean, has written a book called Debunking Economics. I think he was over-ambitious. I think he should have written a book called Junking Economics.

Relationships among the interacting processes of the economy can be discerned, but the economy continually evolves, with the result that the economists are always trying to apply to a new crisis what would have been the solution to the last crisis if anyone had thought of it at the time.

What's worse, they present the transient relationships among x, y, and z as immutable mathematically expressible laws and then award one another Nobel Prizes for the effort. But five years spent gaining a PhD through manipulation of some obscure bit of math will do little to help anyone understand the way the world actually works.

That is why there are few rich economists -- other than those who write the textbooks.

The futility of economics has been made abundantly clear during the present depression. The crackpot Austrian School economists say creative destruction is the way forward. Everyone's got to go bankrupt before the economy can rise, phoenix-like, cleanses of all malinvestment. That's when these nuts plan to sell their "physical" gold and silver for thousands and thousands of dollars an ounce and buy up the world -- that's if a survivalist with a gun hasn't hijacked their stash of precious metals first.

The Keynesians are equally mad. Their solution is more debt. The government must borrow without limit and keep spending until demand swells to suck the tens of millions of unemployed people back into the workforce.

As to who will pay back the debt, they tend not to dwell on that, although if pressed, all they can say is "our kids will handle it."

Then there's the question of what the Keynesians want the government to spend all that money on. They seem to think that every dollar of government spending yields a dollar's worth of public benefit, which is absurd. Most government spending goes on harassing, bullying, brainwashing or shaking down the citizen.

For example, do Americans really benefit from the Homeland Security Administration? One might as well ask whether the Germans benefited from the Gestapo.

Or would American kids be better off with more training in political correctness in the guise of education? Or would Americans be richer if the government subsidized the conversion of more grain to alcohol, or the construction of more windmills?

One could go on. But the cure for today's depression is apparent to anyone giving thought to its cause, which is that the globalized corporations took tens of millions of jobs from workers in Europe and America -- jobs paying ten, twenty, or more dollars an hour -- and gave them to Third Worlders prepared to work a 72-hour week under often dangerous and unhealthy conditions for pennies an hour, people like Steve Jobs, the Walmart Waltons and the Bill Gates pocketing the difference in pay.

Thus the cure for the poverty created by the off-shoring of jobs can only be the repatriation of the same jobs, which can be achieved in one of only two ways.

One is a tariff, much more urgently needed today than in the days of Smoot-Hawley when America had to compete only with the likes of England and France, countries no more competitive that the United States.

The other is some form of wage subsidy, such as I have outlined elsewhere (and here), that would provide employers in the West labor at a price competitive with that avaialable in the Third World, while providing workers with a living wage.

But this is all fantasy. Nobody cares about your income or whether you starve. Nobody who can do anything about it, anyhow. Well, yes, they do care. If you are earning more than a subsistence, they would like to insure that in future you earn less.

Those who rule consider you to be either a useful slave or a useless parasite. They see that in a world of high technology and automation, those who bring nothing to the workforce but a pair of hands are worth no more than pennies and hour and perhaps not even that.

Personal economic survival will increasingly depend on an ability to make oneself useful to the plutocratic elite, which means being some kind of technician able to operate the increasingly automated systems for the production and distribution of goods and the control of the population. For those lacking such talent, there is a final solution. It is called depopulation, and it will be pursued with increasing force and violence as the populace succumbs to economic stress and demoralization.

Economists who blather endlessly about the debt crisis, the financial crisis, the Eurozone crisis serve a useful purpose: they give hope where no reason for hope exists, thus distracting those who might otherwise rebel.

Nothing can effectively impede this drive for a new feudalism except the nation state, which was constructed on the ruins of medieval feudalism. Hence the genocidal assault on the nation states by the plutocratic Neofeudalists. The impoverishment of America will minimize the greatest single threat to those intent on destroying the right of the people to life, liberty and the pursuit of happiness.

Wednesday, July 25, 2012

My Dad's Home Town

My father's family came from the Leicestershire village of Sibbertoft -- at least eleven generations of them, which is as far back as church records go; although they were of Norman extraction, so the line likely extended at the same spot all the way back to 1066. the year of the Norman Conquest.

For nine generations they worked as farm laborers, although my Great Grandpa must have been literate, as he held the post of village clerk. My grandpa moved to the city of Leicester (pronounced Lester), the largest town in the East Midlands, to work in the hosiery trade upon which the 19th and early 20th century prosperity of the city was built.

For thirty years Grandpa managed the Wolsey Limited factory that stood near the centre of the city. Founded in 1755, Wolsey Limited was believed to be the oldest textile firm in England. It was named after Cardinal Wolsey who, in 1530, stopped at Leicester Abbey while on a journey from York to London to face charges of treason. Wolsey alarmed the monks by announcing that he would leave his bones among them, as he did, dying that very evening. The image of Cardinal Wolsey appears as a relief on the fifth floor facade of the Wolsey Limited factory.

My Dad's parents lived just out of town in the village of Fleckney. Dad attended the grammar school in the adjacent small town of Kibworth Beauchamp (pronounced Beecham), where he became head of school and captain of football (soccer). The year he turned 16, he passed the Senior Oxford (i.e., university entrance) exams with honours, and left school with a testimonial from the Head Master stating that "his record as a pupil at this school is better than that of any other during the last eleven years."

But in those days it was considered unnecessary for a boy of that class to enter the university. As the Head Master, an Oxford MA, further stated "a little experience will give him confidence in the abilities he undoubtedly possesses, and he will then be a very valuable worker."

So it was as a worker that Dad went into the hosiery trade, where he lived up to his promise, becoming a factory manager at 18, a managing director at 25 and sales director of a manufacturing group at 30: a promising career that was brought short by a stint in the RAF during WW2.

In 1961, when I went to Leicester as a university student, not a whole lot had changed. The Wolsey Limited factory was still humming. The city still prospered, and was said to have more Rolls Royce motor cars per capita than any other town in England. But despite the flash cars and the fine Victorian and Edwardian mansions in the suburb of Oadby, is was mainly an English working class town, a place of red brick terrace houses of various types from the two down and two up with a front door opening directly onto the sidewalk, to the better sort of lower middle class housing with a yard or two of grass in front and separated from the street by a fence of iron railings.

The relief of Cadinal Wolsey on the facade of
what used to be the Wolsey Limited factory.
Image source.
Today, Leicester is rather different. Wolsey Limited has gone. The name lives on, but only as a marketing device: a good English name to stick on foreign goods. The factory's gone too, replaced by low-cost housing, although the facade with the image of the Cardinal has been retained.

Oddly, the BBC announcer reporting the reconstruction of the building did not know how to pronounce the name Wolsey. She said it with a short "o", which is daft: they knitted socks with wool, not wol, and pronounced Wolsey with a "wool".

But the misunderstanding's to be expected. The BBC encourages the use of regional accents in regional programming and, today, the voice of Leicester is the voice of ethnic Britain. From 212 thousand in 1901, the indigenous English population of Leicester has fallen by a third, while the ethnic population, chiefly, Hindu, Muslim and Sihk, has gone from nothing to more than 51% of the population in 2011 and is still growing fast.

The English are now past the tipping point in a town that has been their home for more than 2000 years and which played a critical role in their history. They are the minority. They have been ethnically cleansed, not by a conquering army, but as a matter of deliberate policy by their own government.

Dad was a man of pacific temperament. During the 30's he was a peace activist. Yet he understood the place of violence in history, and when it came to the crunch, volunteered for service in the struggle against Nazi tyranny. He believed the independence and liberty of England was worth fighting for.

Dad was no racist. He did business with all kinds and conditions of men and formed friendships with many, including immigrants from the Indian subcontinent. But he was patriot who would have considered the likes of Blair and Cameron, Clegg and Milliband traitors for what they have done to his home town: men worth fighting to expose, depose, and punish.

Tuesday, July 24, 2012

My Britain is fuck all now

Emma West, who appeared in a YouTube video publicly bemoaning the takeover of her English town by immigrants, is both an annoyance and a threat to the politically correct British state.

Emma West. Image source
Dammit, the media can't even call her a racist. They have to call her the tram race rant accused, or the author of an alleged racist rant.

The trouble is, even if a court rules that Emma West's remarks were "racist", they cannot without absurdity, deny that they were true. So a court must declare either that truth trumps political correctness or that political correctness trumps truth. Either way, the admission will do significant damage the credibility of the politically correct state.

To be specific, here's exactly what Emma West said. And no, it's not polite. It's not what I would have had the nerve to say, even if I had been so inclined. And it might very well be deemed liable to cause a breach of the peace. But it's the truth.

For example:
What's this country come to? A load of Black people and a load of fucking Polish, a load of fucking East… Yeh.
So it's not just black people or Asians she's bothered about. She's objecting to the fact that Britain's towns and cities are being overwhelmed by foreigners, including white Polish Europeans. Then there's her response to the black woman who says:
If we don't come here you guys don't work. You guys don't work. We have to do the work for you.
How's that for the settler mentality? Racist too. But in any case, here's Emma West's response:
I work. This is my British country until you lot come over.
And that's her real offense. She's claiming England for the English.

Opposing the genocide of your own people is racism, according to the globalist shills who run all three major political parties in Britain.

Yeah, genocide. The term genocide was coined by the Polish Jew, Raphael Lemkin. To him, notwithstanding the Jewish Holocaust, genocide was not necessarily or even usually a business of bullets and poison gas:
More often it refers to a coordinated plan aimed at destruction of the essential foundations of the life of national groups so that these groups wither and die like plants that have suffered a blight. The end may be accomplished by the forced disintegration of political and social institutions, of the culture of the people, of their language, their national feelings and their religion. It may be accomplished by wiping out all basis of personal security, liberty, health and dignity. When these means fail the machine gun can always be utilized as a last resort. Genocide is directed against a national group as an entity and the attack on individuals is only secondary to the annihilation of the national group to which they belong.
And it is precisely for stating that genocide is what is happening to the English in Croydon, that the media are itching to call Emma West a Racist. And it is precisely why the state seems determined that Emma West should either plead not guilty by virtue of insanity or admit that she is a racist.

How well the state has learned the lesson spelled out in George Orwell's 1984. Love is hate, peace is war, freedom is slavery, and now thanks to the cunts ruling England since that queer sod Ted Heath kicked Cyril Osborne out of the Tory party caucus for saying England was a white country for white people, opposition to genocide is racism.

See also,

Sean Gabb: More thoughts on Emma West

Peter Hitchens: What’s that noise? They’re Building a Coffin for Liberty

Who Rules?

Andrew Gavin Marshall says it's the bankers who rule, and in particular the dynastic banking families and their network of think tanks that have:
socialised the ruling elites of each nation and the international community as a whole, into a cohesive transnational elite class. The foundations they established helped shape civil society both nationally and internationally, playing a major part in the funding – and thus coordinating and co-opting – of major social-political movements.
This is the New World Order conspiracy founded by Cecil Rhodes, his financier friends, Lord Rothschild and Alfred Beit, the journalist and long-time Editor of the Times, William Stead, and Alfred Milner, who played a central role in the shaping of British foreign policy in the post-WW1 era.

Carroll Quigley's account of this so-called Rhodes-Milner group, completed in 1949 although not published until 1981, leaves the reader to understand that by the onset of WW2 the project was dead. But we know that the Council on Foreign Relations, one of many public faces of Rhodes' project for global empire, remains very much alive and that the successors to the bankers such as J.P. Morgan and John D. Rockefeller who funded Rhodes' project in its earlier days, remain as committed as ever to global governance.

Aangirfan, in Our Secret Government, offers a different perspective. The West is ruled by a US-NATO controlled secret government that uses terror and assassination to eradicate opponents and to compel public submission to an increasingly totalitarian system of control.

These two views of the world are not necessarily incompatible. A secretive plutocratic elite, employing the media it owns, the financial resources it controls, can dictate the outcome of most elections with money and propaganda. What's more, they can heavily influence the actions of most elected officials through bribes, paid in the traditional way after the candidate leaves offices. Thus, for example, Tony Blair, a key enabler of the Iraq war is the recipient of, among many interesting income streams, an annual director's fee of more than $2 million from JP Morgan.

Thus is plutocratic control concealed by a facade of democracy. But the success of the Western system of control depends entirely on its appearance of spontaneity. Unlike the Soviets who absurdly insisted on elections in which everyone voted for the government's own candidate or went to jail, Western states have elections that can still generate excitement. Many an election looks like a cliff-hanger. Thus is preserved the illusion that the little guy has his say.

But sometimes things go wrong. The Kennedy's, with the help of Richard Daly, the resourceful mayor of Chicago, managed to stuff more ballots than Nixon's team and JFK was elected. Then Kennedy seemed to think that, as President, he could make his own decisions, not just front for someone else's. He failed to back the CIA's Bay of Pigs invasion of Cuba. Then he wimped out of a head on nuclear show-down with the Ruskies over Soviet missiles in Cuba, preferring instead to make a deal with Kruschev behind the backs of Joint Chiefs.

But Kennedy was soon gone, shot from behind in the front of the head, at near impossible range with a crap WW1 Italian rifle by a patsie befriended by an associate of George H. W. Bush who committed suicide the day, in 1977, he was to be interviewed by an investigator for the House Select Committee on Assassinations.

Soon things were back on track. LBJ, with a wink from a friend, stepped up to the Presidency and set about sending 600,000 US troops to Vietnam.

But if LBJ was complicit in the actions of elements of a secret government, he was no fool. He was a real politician with a program of his own:
The purpose of protecting the life of our nation, and preserving the liberty of our citizens is to pursue the happiness of our people. Our success in that pursuit is a test of our success as a nation. ... The challenge of the next half century is to determine whether we have the wisdom to use [our] wealth to enrich and elevate our national life and to advance the quality of our American civilization. ...The Great Society rests on abundance and liberty for all. It demands an end to poverty and racial injustice...
Not quite the plutocrat's dream. And what's that about the success of the American nation? Mentioned four times in two sentences. That ain't the politically correct empire we're aiming for.

Which suggests that at some point, the agents of plutocracy determined to get control of the process by which individuals are vaulted into leadership at a stage much earlier than the election campaign.

Does that explain the emergence of the PR flack as national leader? The Quisling non-entities, Tony Blair, Dubya, David Cameron: men with no real work experience; men who have risen without trace; men who pursue the war for global empire without hesitation; men who pursue the genocide of their own people through the destruction of their nation as a racial, cultural and religious entity; men so unerringly setting the world on course for an economic disaster that will precipitate massive global depopulation?

And if the whole apparatus of democratic government is now a charade, how has that be accomplished other than by means of a secret apparatus engaging in the most ruthless manipulation of events, including the resort to terrorism?

But how does a secret government, elements of which clearly exist, function in relation to the more or less legal and relatively transparent application of the money power to the drive for global governance?

The answer is that the two are coordinated via the security services of the various states. The security services are created by the state, but they are not necessarily subject to legitimate state authority. Mrs. Gandhi was murdered by her own bodyguard. President Sadat was murdered by his own military despite four layers of security and eight bodyguards. President Kennedy's murder depended on blatant treachery by his Secret Service bodyguard.

But if the state does not control the security services, who does?

In the answer to that question is the truth of who rules. But whoever the puppet-masters may be, of one thing we can be sure, the West is now subject to a tyranny no less evil, no less destructive of the people, and no less brutal than any that has preceded it.

Saturday, July 21, 2012

Li(E)bor Banks: Too Big to Jail

The confidence in the system is so fragile still… a disclosure of a fraud… could result in a run, just like Lehman.

Tim Geitner, US Treasury Secretary
 When the banks rush to offer $40 billion in compensation -- more than the estimated penalty to be paid by BP for the Gulf Oil Spill, the alleged greatest environmental disaster in the history of the universe -- we can be sure they are attempting to stave off much more severe punishment.

Like what?

Well how about sixteen times more severe. There were sixteen banks involved in fixing Li(E)bor. They've already agreed to contribute to a group penalty, a clear acknowledgement of guilt. So why not have each of them contribute $40 billion to a compensation fund for those who've been ripped off, this amount not to constitute a limit on their liability.

But this penalty should not come solely at the expense of bank shareholders. In the first place, the payment should be funded by repayment of all directors and traders salaries, bonuses and incentives in excess of $1 million per year for the duration of the Li(E)bor scam.

Now some would say leaving the bastards with even a million bucks a year is too generous. But remember champagne and caviar don't come cheap, and we are not proposing to force them into literal starvation.

But in addition, there must be a reconstruction of the banking industry. The high street banking sector must be separated from the investment banking business and established on a depositor-owned basis, like the credit unions, or in Britain, the Building Societies that were acquired by geniuses such as the, former sir, Fred Goodwin of the bailed out Bank of Scotland.


As for the rest of the banking industry, I recommend exile to the Bahamas or some other cockroach infested place where they could mug one another to their hearts content.

Reducing Americans to Slavery, One terrorist Attack At a Time

Colorado Batman shooting staged? 

See that's what happens when you allow citizens to bear arms. This fella was just a normal decent guy, yet he went and killed a whole lot of innocent people.  You just can't trust decent people with weapons.

Was Batman Shooter on anti-depressants?

There you are. Now that more than a quarter of adult Americans are diagnosed as mentally ill in any year and thus dependent on very expensive, very profitable and highly toxic proprietary anti-depressants and anti-psychotic drugs, you absolutely cannot trust them with guns.

Lone Wolf Domestic Terror Rhetoric Will be Used to Ban Guns

A chilling new video has surfaced on the internet at an opportune time for the establishment to push for total gun confiscation via congress and possibly through a new UN treaty.

The fact that the video is calling for “domestic terror” attacks within the United States borders is uncanny, and almost to unbelievable. ...


Or as Adolph said:
The most foolish mistake we could possibly make would be to allow the subject races to possess arms. History shows that all conquerors who have allowed their subject races to carry arms have prepared their own downfall by so doing. Indeed, I would go so far as to say that the supply of arms to the underdogs is a sine qua non for the overthrow of any sovereignty. So let's not have any native militia or native police. German troops alone will bear the sole responsibility for the maintenance of law and order throughout the occupied Russian territories, and a system of military strong-points must be evolved to cover the entire occupied country.

Adolf Hitler, dinner talk on April 11, 1942, quoted in Hitler's Table Talk 1941-44: His Private Conversations, Second Edition (1973), Pg. 425-426. Translated by Norman Cameron and R. H. Stevens. Introduced and with a new preface by H. R. Trevor-Roper.

Gun Control: The Nazi Paradigm: Steven P. Halbrook, PhD

Commented the New York Times about the interrelated rights which the Nazis destroyed wherever they went:

Military orders now forbid the French to do things which the German people have not been allowed to do since Hitler came to power. To own radio senders or to listen to foreign broadcasts, to organize public meetings and distribute pamphlets, to disseminate anti-German news in any form, to retain possession of firearms--all these things are prohibited for the subjugated people of France . . . .7
While the Nazis made good on the threat to execute persons in possession of firearms, the gun control decree was not entirely successful. Partisans launched armed attacks. But resistance was hampered by the lack of civilian arms possession.

Friday, July 20, 2012

Brassed Off: A tribute to the best men in the world

It breaks my heart to see what is happening in our country today - this terrible strike of the best men in the world, who beat the Kaiser's army and beat Hitler's army, and never gave in. Pointless, endless.

Harold MacMillan, former Conservative Prime Minister. Maiden speech, House of Lords, November 14, 1984: speaking of the 250,000 British coal miners who were eventually axed by the Thatcher government.
Tara Fitzgerald as Gloria in Brassed Off
Image source
If you didn't know that a brass band could bring tears to your eyes, try Mark Herman's movie, Brassed off (or here  Part 1 and here Part 2), before YouTube takes it down. 

The soundtrack for the film was provided by the Grimethorpe Colliery Band.

Thanks to Steve Early for the link and an account of the betrayal of the working people of Britain by the likes of Tony Blair and Ed Milliband.

Banks in Li(E)bor probe consider group settlement

Reuters reports that:
A group of banks being investigated in an interest-rate rigging scandal are [sic] looking to pursue a group settlement with regulators rather than face a Barclays-style backlash by going it alone, people familiar with the banks' thinking said.
LOL. Caught in the biggest fraud in history, what the banks are saying is:
Hey you regulator guys, here's $40 billion, now shut the fuck up.
An offer the regulators can surely not refuse, since they've been complicit in the scam from the outset, and because a serious probe of Li(E)bor could expose the conspiracy among the initiates of high finance that allows privately owned corporations to print money ad lib, thereby sequestering for themselves the value of the savings of the middle class.

In which case there could be trouble. Like this.

Which prompts me to draw attention to a revolutionary banking scheme that would see an end to:
The creation of money by private companies run by executives rewarded according to the scale of financial swindling they can get away with.

Money laundering -- as undertaken on a multi-billion-dollar scale by HSBC under CEO Lord Green, now Britain's Minister of State for Trade and Investment in both the Department for Business, Innovation and Skills and the Foreign and Commonwealth Office (Yes that's his official title. No wonder the Brits are in a terminal decline: mind-bending bureaucratic verbiage rules even at the highest political level.).

Virtually all forms of financial fraud, counterfeiting, tax evasion, the vending of illegal drugs,the trading in slaves, the payment of illegal political campaign contributions, payments to out of office pols like Tony Blair for services rendered, and the financing of terrorism. All would all be immediately detectable, and the culprits immediately identifiable.
What's the plan? It is the use of pure cardinal numbers, issued by a government agency. Briefly, here is how it works:
A Numero, pronounced with emphasis on the second syllable, is a unit of currency designated by a unique whole number. If you "own" the Number 1, you have a unit of currency. To own the Number 1, you must have an account with the monetary authority or a bank acting as the agent of the monetary authority, which registers your ownership of the Number 1.

Additional units of currency are created by the use of additional cardinal, or counting, numbers up to a published total based on a country's existing stock of money (or in economist speak, M2), which for the United States is currently around $10 trillion. Thus, the ownership of every single number, i.e., each distinct Numero, would be recorded, the information held in a geographically distributed, nuclear-attack hardened, and highly redundant electronic archive.
I explained in my original account of the Numero, the simple procedures for converting an existing currency to the Numero, and some of the implications of adoption of this form of money.

Comment about the Numero in a discussion on Steve Keen's blogsite, expressed enthusiasm for the ideas. Also, as one might have expected, the idea was grossly misrepresented by a person who is either confused or a dupe or a shill of the banking industry.

Here, therefore, to make a few things unequivocally clear, I will add a couple of comments on my original proposal.

The Numero can be used globally, in which case the unique number designating each unit of currency would have the prefix G, for G(lobal)Numero.

Against the GNumero, is the fact that its issuance would depend on an international body of some kind, which smacks of the project for global governance that many oppose. Moreover, it creates the adjustment problems that result from the use of gold or any other form of money that cannot be debased at the whim of political operators.

The adjustment problem is at the root of the Eurozone financial crisis. The PIIGS have priced themselves out of the common market with Germany, Netherlands, Finland, etc. The only way they can get back into the game is either to revert to their original crap currencies and debase like hell, or cut their Euro-denominated prices and incomes sharply. Instead, they hope to force the Germans to spend their brains out creating the demand that creates the jobs to employ the army of unemployed people in Greece, Spain, etc.  -- obviously a plan that will go nowhere.

In fact, the adjustment problem is not as hard to solve as most people think. As I explained here, all that's needed is a periodic adjustment of wages on a national or regional basis, according to the unemployment rate. By undertaking such wage adjustments on an across-the-board basis, the unfairness argument against taking wage cuts, should such be necessary, loses all force.

But folks hate this idea. It forces one to confront the the fact that, through the World Trade Organization, the West agreed to free trade with the Rest, including about four billion people prepared to work for pennies an hour. Instead of accepting this fact and preparing to make the necessary radical adjustments, most people in the West, it seems, would rather their government keep debasing the currency, borrowing insane amounts that can never be repaid, and as necessary, waging wars for oil.

But for those who want national currencies that can be endlessly debased, then the Numero can be implemented nationally. In that case the unique number designating each unit of currency would have a prefix UK, DE, or whatever, to indicate the nation of issue. In fact, the Numero might be implemented on a regional or even a city basis, which could make a lot of sense. Why, after all, if the Euro is not equally suitable to the Greeks and Germans, is the Pound Sterling equally suitable to Londoners and Hebridean Islanders?

The creation of national or regional Numeros would make necessary the exchange of currencies. But as all Numero transactions would be electronic, currency conversion would be an instantaneous and almost cost-free process, the rates of exchange being determined by markets with or without intervention by central banks, as at present.

Wednesday, July 18, 2012

Jews “own a whole freaking country” and we're not talking about Palestine

By Kevin MacDonald

Occidental Observer, July 11, 2012: Well, it turns out after all that Jews do control the media—and a whole lot besides. So says Manny Friedman, writing in the Times of Israel (Yes, Jews DO control the media).  Of course, we at TOO have known this for quite a while, but it’s nice to hear it from a Jew, even though it’s in a Jewish publication and intended to be part of a Jews-only dialog.

The thing is, it’s okay for someone like Friedman to say it (or Joel Stein, writing in the LATimes and linked by Friedman). But it’s definitely not okay for someone like me.

In fact, Friedman is typical of Jewish writers who inhabit a completely Jewish universe when they talk about anything relating to Jews. Friedman is well aware that non-Jews who talk about such issues should prepare for a wall-to-wall, no-holds barred, 24/7 campaign against them:
The funny part is when any anti-Semite or anti-Israel person starts to spout stuff like, “The Jews control the media!” and “The Jews control Washington!”
Suddenly we’re up in arms. We create huge campaigns to take these people down. We do what we can to put them out of work. We publish articles. We’ve created entire organizations that exist just to tell everyone that the Jews don’t control nothin’. No, we don’t control the media, we don’t have any more sway in DC than anyone else. No, no, no, we swear: We’re just like everybody else!
Does anyone else (who’s not a bigot) see the irony of this?
I don’t see any “funny parts” to this, and I rather doubt that “irony’ is the right word here. How about “ethnic strategizing,” as in “Does anyone else (who’s not a bigot) see the ethnic strategizing of this?”

Anti-Semitic Geography

Jews DO control the media: But only Jews and anti-Semites acknowledge the fact

The Times of Israel, July 1, 2012: We Jews are a funny breed. We love to brag about every Jewish actor. Sometimes we even pretend an actor is Jewish just because we like him enough that we think he deserves to be on our team. We brag about Jewish authors, Jewish politicians, Jewish directors. Every time someone mentions any movie or book or piece of art, we inevitably say something like, “Did you know that he was Jewish?” That’s just how we roll.

We’re a driven group, and not just in regards to the art world. We have, for example, AIPAC, which  was essentially constructed just to drive agenda in Washington DC. And it succeeds admirably. And we brag about it. Again, it’s just what we do.

But the funny part is when any anti-Semite or anti-Israel person starts to spout stuff like, “The Jews control the media!” and “The Jews control Washington!”

Tuesday, July 17, 2012

The Treason of Nicolas Sarkozy

"Métissage" - It's An Obligation! 

 

GalliaWatch, December 20, 2008: In a recent post I gave a few highlights of the speech delivered by Nicolas Sarkozy on December 17 to the students of the Ecole Polytechnique in Palaiseau.

But I had missed the best part.

The website of Francois Desouche provides a short video from that speech, which can be viewed in its entirety (45 minutes) at several websites including Daily Motion.

The excerpt in question centers on France's obligation to become a mixed country - that troublesome word "métissé" is once again at the heart of his incredibly threatening speech. The verb "métisser" theoretically means to mix blood or to crossbreed, but at times it is used more loosely to mean mix cultures. Sarkozy uses the word, or a form of it, at least 7 times in the first few seconds of the video. Whether he is referring to the mixing of blood or merely destroying French culture by bringing in hostile aliens, it is impossible to avoid the fact that he is telling the French people, in terms that have never been so menacing, that they have to mix, or else.

What madness has the election of Obama wrought in the mind of this unFrench-man?


Here is my rendition of his words. It is far from perfect, because his grammar seems a bit off at times. Except for two places, I have retained the French word "métissage" (crossbreeding), and it's various verbal and adjectival forms, since "crossbreeding", "racial mixing" and other similar terms don't always convey the right meaning. "Crossbreeding" sounds too scientific, as when farmers crossbreed crops. "Miscegenation" is too technical and refers to marriage. "Mongrelization" and "bastardization" are too graphic. It looks as if "métissage" will join "laïcité" and "communautarisme" as French words that are so troublesome, it's better to just leave them.

However, if you have suggestions, feel free...

"(...) the objective is to meet the challenge of "métissage" - the challenge of "métissage" that the 21st century is confronting us with. The challenge of "métissage", France has always been familiar with it, and by meeting the challenge of "métissage" France remains faithful to her history. Moreover, it is consanguinity that has always provoked the end of civilizations and societies.

Note: In the above sentence we see that he IS talking about racially mixing the BLOOD of his compatriots with foreigners (and we know that the foreigners in question are not Swedes or Italians).

In the course of centuries, France has always known "métissage", France has always been "métissée".

Note: This is insanity. France has never been "métissée" in the way he is using the word. He is attempting to equate the mixing of the Franks, Latins and Celts with the mixing of white and black or of European and North African Muslim.

France has crossbred cultures, ideas and histories. France, who was able to crossbreed these cultures and these histories, constructed a universal language, because France herself is universal in the diversity of her origins.

Note: I'm not certain what he's trying to say except that out of the racially diverse mix, comes something universal. That may or may not be true, but it is not the point. Why does he want to destroy the civilization that grew and flourished over the past 2000 years, from the Roman Empire, to the Second World War? What is his complaint about French civilization, other than he doesn't like it very much?

Ladies and Gentlemen, this is the last thing: If republican will power does not function, it will be necessary for the Republic to resort to even more forcible methods.


Note: It is the above sentence that has Desouche's readers reaching for their guns.

But we don't have a choice. Diversity at the base of the country must be reflected by diversity at the head of the country.

Does this mean he will resign in favor of Dieudonné?

It is not a choice. It is an obligation. It is an imperative. We cannot do otherwise at the risk of finding ourselves faced with considerable problems.

We must change, so we will change.

For a man who only looks to the future, who admittedly cares nothing for the past, Nicolas Sarkozy seems to be completely out of step with the needs of his people. They did not elect him to change the DNA of the country, but to improve their lot, to fight crime, to reduce immigration, and to restore a sense of national pride. Of all the betrayals France has endured, this is the unkindest cut of all. 

François Desouche has over 200 comments from readers. They range from "Let's take our families and get out of Europe" to "Send this guy to the gibbet".

I like the second suggestion.

See also:

 Council of Conservatives French president calls for preferential treatment for non-whites. Says the French have a duty to “metissage” (miscegenate).

 Brussels Journal The Engineer of Diversity

Sunday, July 15, 2012

New Labor and the Genocide of the English

By Robert Henderson

England Calling, July 13, 2012: The leader of the Labour Party Ed Milband has cynically climbed onto the bandwagon which  Labour politicians like  John Crudas, Harriett Harman and John Denham  tentatively started rolling before the last election  as they began to fret over losing the votes of the British white working class, the vast majority of whom live in England.  The bandwagon is England, the English and Englishness.  Miliband’s  boarding point was a speech in the Festival Hall on 7th June (http://www.labour.org.uk/ed-miliband-speech-defending-the-union-in-england,2012-06-07).

Miliband decided to break the habit of a generation of Labour politicians  by referring to the English in terms which did not suggest that  they were the brutish enemy of all that is right and good and dangerous to boot , viz:

“I believe we can all be proud of our country, the United Kingdom.
And of the nations that comprise it.
Second, that means England too. [RH: Damned decent of the fellow]
And those on the left have not been clear enough about this in the recent past.
We must be in the future.
We should embrace a positive, outward looking version of English identity.
Finally, we should also proudly talk the language of patriotism. “

How dramatic  a shift of opinion and language  this was can be gleaned from the  things which Labour ministers and backbenchers  were saying about the English only a few years before. Here is  Jack Straw when Home Secretary in the Blair Government:

“The English are potentially very aggressive, very violent. We have used this propensity to violence to subjugate Ireland, Wales and Scotland. Then we used it in Europe and with our empire, so I think what you have within the UK is three small nations…who’ve been over the centuries under the cosh of the English. Those small nations have inevitably sought expression by a very explicit idea of nationhood. You have this very dominant other nation, England, 10 times bigger than the others, which is self-confident and therefore has not needed to be so explicit about its expression. I think as we move into this new century, people’s sense of Englishness will become more articulated and that’s partly because of the mirror that devolution provides us with and because we are becoming more European at the same” (BBC Radio Four’s Brits  10 January 2000 http://news.bbc.co.uk/1/hi/uk/596703.stm )

And here is a Labour backbencher , the German Gisela Stuart. From 2005:

Political Correctness as a Weapon of Class War

By Colin Liddell

Alternative Right, July 14, 2012: The case of footballer John Terry has once again brought the issues of racism and political correctness into the media spotlight. As these pustulent entities sit there baking in the glare, they emit a miasma of side issues and discussion points that the mainstream media dutifully spins in appropriate ways.

This time Terry got off with calling opposing player Anton Ferdinand a "fucking Black cunt." Apparently his lawyers were a lot better than those of Emma West. But he's not out of the woods yet. The Football Association, which got egg on its face when they prematurely removed him from the captaincy of the English national team, is set to reopen its own investigation into the incident, with possible sanctions and stigma beckoning for Terry.

The main reason for Terry's acquittal may have been his actual innocence. It is obvious that the man who has successfully captained the multiracial Chelsea team for several seasons can't be what most people understand to be a "racist." But since when has the thoughtcrime industry been interested in innocence?

Bank Fraud and Asymetrical Power

By Naomi Wolf

The Guardian, July 14, 2012: The media's 'bad apple' thesis no longer works. We're seeing systemic corruption in banking – and systemic collusion.

Last fall, I argued that the violent reaction to Occupy and other protests around the world had to do with the 1%ers' fear of the rank and file exposing massive fraud if they ever managed get their hands on the books. At that time, I had no evidence of this motivation beyond the fact that financial system reform and increased transparency were at the top of many protesters' list of demands.

But this week presents a sick-making trove of new data that abundantly fills in this hypothesis and confirms this picture. The notion that the entire global financial system is riddled with systemic fraud – and that key players in the gatekeeper roles, both in finance and in government, including regulatory bodies, know it and choose to quietly sustain this reality – is one that would have only recently seemed like the frenzied hypothesis of tinhat-wearers, but this week's headlines make such a conclusion, sadly, inevitable.

Friday, July 13, 2012

The global scam that may prove terminal for Barclays, Lloyds and RBS

By Ian Fraser

IanFraser.org, July 1, 2012: Executives and former executives of the Royal Bank of Scotland, Lloyds Banking Group, HSBC and Barclays are at risk of criminal action, including possible extradition to the United States, in the wake of evidence of their concerted attempts to rig global interest rates, according to senior legal experts.

RBS, Lloyds and HSBC are also facing even larger fines than Barclays’ £290 million fine because of their involvement in the alleged international cartel.

William K Black, an associate professor of economics and law at the University of Missouri-Kansas City, told the Sunday Herald that anyone who is found to have manipulated Libor or condoned such practices at a senior level in a bank should face criminal prosecution. He suggested UK based directors and staff, such as the former RBS chief executive Fred Goodwin, could be liable for extradition to the US.
Black, a world-leading expert on financial crime said:
“The reports of systematic falsification of Libor reports, if accurate, constitute felonies under US antitrust law that should be prosecuted vigorously, as should the systematic cover up.”
The US Justice Department has confirmed its criminal division is investigating banks other than Barclays. It said:
“The Justice Department’s criminal investigation into the manipulation of Libor and Euribor by other financial institutions and individuals is on-going.”
Industry sources said executives from Barclays, HSBC, Lloyds and RBS are at risk of extradition hearings, since evidence suggests that US dollar Libor was was one of the benchmarks that was manipulated. Seventy percent of the $500 trillion global swaps market is based on US dollar Libor, with American counterparties likely to have been most affected.

Move America’s economic debate out of its time warp

By Jeffrey Sachs

FT Blogs, July 12, 2012: America’s economic debate is stuck in a time warp. On the one side, Mitt Romney’s conservative advisors defend tax cuts for the rich and spending cuts for the poor as if we hadn’t just lived through 30 years of failed Reaganomics. On the other side, Paul Krugman defends crude Keynesianism as if we’ve learned nothing in recent years about the severe limitations of short-term fiscal stimulus. Both sides merely raise their decibel levels at each announcement of bad news, as with last Friday’s data showing the failure of the US economy to generate sufficient new jobs in June.

The two sides of the debate live in timeless and increasingly irrelevant ideologies. The prescriptions of free market economics peddled by the Republicans – slash taxes and spending, end financial and environmental regulations – are throwbacks to the 1920s, far more naïve than even modern conservatives such as Milton Friedman and Friedrich Hayek, who recognised the need for government intervention for the poor, the environment, health care and more. Today’s free market ideologues are uninfluenced by the lessons of recent history, such as the financial crisis of 2008 or the devastating climate shocks hitting the world with ever-greater frequency and threatening far more than the economy. Their single impulse is the libertarianism of the rich: the liberty to enjoy one’s wealth no matter what the consequences for the economy or society.

The other side is only a little better. In Paul Krugman’s telling, we are in the 1930s.  We are in a depression, even though the collapse of output and rise of unemployment in the Great Depression was incomparably larger and different in character from today’s economic stagnation.  Krugman channels Keynes, yet Keynes lived in a very different era.

In Krugman’s simplified Keynesian worldview, there are no structural challenges, only shortfalls in aggregate demand. There is no public debt problem. There is no global competitiveness challenge, since “competitiveness” is a myth when applied to national economies. Fiscal multipliers are predictable, timeless, persistent, and large. All growth reversals can be solved through larger deficits. Politicians can be trusted to design short-term stimulus spending programmes of hundreds of billions of dollars. Tax cuts are about as good as increases in government spending, and short-term boosts in spending are about as good as long-term public investments.  Not one of these conclusions stands scrutiny.

Why have we come to this vacuous debate between a free-market extremism and a Keynesian superficiality that addresses none of the subtleties, trade-offs, and uncertainties of the real situation? There are probably two main reasons. First, the world is noisy and overloaded with media messaging. Getting heard seems to require a short, sharp and exaggerated idea endlessly repeated: economics as a media brand. Second, the world is facing novel problems at the global level, and novelty is hard to factor into economics, which is a rigid, ideological, theoretically based, and largely backward-looking field.

Here are some of the new problems of macroeconomic significance.
First, the financial markets are global while regulation is at best national (and sometimes almost non-existent or criminal). This is killing the euro, but it is also undermining financial regulation and monetary policy everywhere. The US and UK are far more interested in defending Wall Street and the City than in fixing the global regulatory landscape. Germany has been much more interested in coddling its errant banks than in fixing the eurozone banking system.
Second, the world of work is being fundamentally transformed. Low-skilled work is the work of offshore workers, or immigrants, or machines.  In high-income countries, the only route to middle class jobs is through education, skills and active labour market policies that match jobs and needs. Germany and other countries of northern Europe have generally succeeded in creating these institutions.  The US and southern Europe have generally failed.  Keynesian aggregate demand cannot create long-term employment for the low-skilled workers left to sink or swim in today’s globalised labour market.  Only temporary bubbles (such as the dotcom bubble of the late 1990s or the housing bubble of the 2000s) briefly employ the low-skilled, but soon they unemployed again when the bubbles burst.

Third, tax collections today are little more than a Swiss cheese of tax evasion and tax havens for the rich and corporations. VAT and payroll taxes can still be collected while capital income of all kinds increasingly escapes taxation. These trends greatly exacerbate the market forces pulling to increase inequality of wealth and income.

Read more

Wednesday, July 11, 2012

The Zombification of the West

By BRET STEPHENS The Wall Street Journal, July 9, 2012: When is an economic crisis more than just an economic crisis? When is it also a political crisis? And when is it something else altogether: social, demographic, institutional, moral, intellectual—in short, civilizational?

The euro zone's troubles shouldn't be difficult to understand: Pair overspending governments with over-regulated economies and sooner or later the Continent was bound to lose the confidence of the markets.

Normally, such a crisis could be resolved by slashing corporate and marginal tax rates and red tape in order to encourage investment, enterprise and risk-taking. Instead, European policy makers have pursued every conceivable fix, from serial bailouts to a banking union, in order to circumvent having to address the core problems. As a result, the crisis continues to worsen: In Spain, for instance, bank-deposit flight has only gathered pace since last month's $125 billion bank bailout. ...

Read More

How Quisling Leaders Surrender National Independence to Global Corporate Control



See also: The Facist New World Order

Tuesday, July 10, 2012

Why Mish is wrong about tariffs

Mish reports that,
Mitt Romney has pledged to designate China a "currency manipulator" and impose duties on its imports if the yuan isn't allowed to float freely.
If Romney increases tariffs, says Mish
three things will happen, all of them bad:
  1. Prices will rise
  2. Growth will slow
  3. China will retaliate with tariffs of its own or by buying more goods from Europe instead of  goods from US produces 
In essence everyone will pay higher prices for goods and services in hopes of bring back a few hundred manufacturing jobs (while losing tens-of-thousands of jobs in the ensuing economic slowdown).
On Point 1, Mish is correct. Prices would rise. But is that bad if it means your neighbor returns to work?

On Point 2, Mish is clearly wrong. If Americans resume manufacturing shoes and shirts, computers and car parts for one another, the net effect would be increased consumer spending, not only nominally, due to higher prices, but also in real terms, as millions of the presently unemployed once again receive a pay check.

On Point 3, Mish fails to explain where China will buy oilseed, pulp and paper, copper and other commodities it presently buys from the US, or why it would matter if China did buy elsewhere since all are fungible commodities that the US can sell to those who would otherwise have bought what China buys from sources other than the US.

As for the rest of China's US purchases, they're pretty much a drop in the bucket.

What's more, it's difficult to see China deliberately hurting the US when the terms of China's trade with the US are currently so overwhelmingly in China's favor. But if Chinese tariffs were to hurt US exports significantly, they would tend to drive down the value of the dollar, making the US more competitive internationally, precisely Romney's objective.

Mish's final point, that tariffs would "bring back a few hundred manufacturing jobs," is highly misleading. Tariffs that truly protected American industry would bring back literally millions of jobs, many of them well paid.

So, yes, with tariff protection, Americans would end up paying more to buy from one another instead of buying wherever in the World they can get the lowest price. But which do Americans want:

to trash their neighbor's job to save a few bucks on a shirt, a pair of pants, or to save a thousand or two on the price of a car?

Or is America a nation where people actually give a damn about one another?

Even balanced trade between the West and Rest threatens your job

Earlier I explained how the US/EU's half-trillion-dollar-a-year trade deficit with China has destroyed millions, and probably not less than several tens of millions, of jobs in the West.

But even if trade were balanced, the West suffers job losses as a result of trade with Third World nations where many factory workers still still earn no more than a dollar or two a day.

How so?

Because whereas importing a pair of jeans with a price at the factory gate in China of less than five dollars displaces several hours of a US garment worker's labor, the countervailing export of five dollars worth of Hollywood movies or Canadian oil or gas generates no more than a minute or two of North American employment.

The reason for that lies in the ten- to twenty-fold difference in wages that still exists between the West and the Rest, a circumstance that David Ricardo, author of the principle of comparative advantage, did not envisage when considering trade in wine and cloth between England and Portugal.

True, if David Ricardo's theory of comparative advantage were applicable, which it isn't, then US garment workers displaced when China took half the US textile and garment market between 2001 and 2012 might find employment as Hollywood actors, camera operatives or make-up artists.

But of course they won't, anymore than significant numbers of the Detroit machinists who lost their jobs as China and other Third World nations took most of the North American car parts industry will become computer programmers or IT workers. For one thing, most software and IT jobs have already gone to India, China and other countries where brains as good as those available in North America can be hired for less than one tenth the price.

For most of those driven out of the labor market by cheap Chinese textiles, electronics, computers and car parts, that's it: they'll never get a job comparable to the one they lost and many will not get a job at all.

So much for the benefits of global free trade via the miracle of comparative advantage so often touted by liberal economists with Nobel prizes.

How globalization destroys Western prosperity

Liberal economists committed to the cause of globalization reassure those concerned about cheap Third World imports destroying jobs in the West with some vague reference to David Ricardo's principle of comparative advantage, which so they imply, proves that unrestricted international trade is always beneficial to all parties.

Thus Joseph Stiglitz, in his latest pot-boiler, makes a hand-waving reference to "China's comparative advantage," while Jeff Rubin assures his readers that concerning the invariable benefit of free trade, Ricardo "nailed it."

But what the shills for globalization fail to mention is that comparative advantage, as Ricardo defined it, presupposes immobility of capital, a condition that certainly does not apply in a globalized economy, where international corporations readily move capital and technology from high- to low-wage countries, thus robbing the latter of the benefit of the capital and technical expertise accumulated through the sweat and toil of generations.

But in any case, the principle of comparative advantage can only apply where there is two-way trade. But today, in its trade with the Third World, the West imports massively greater quantities of goods than it exports, the resultant deficits being covered by loans.

For example, in 2011, the US imported from China, alone, goods valued at $399 billion while selling to China goods valued at only $104 billion (Source), the difference being largely covered by Bank of China investment in pieces of paper, aka US Treasury bills.

The 27 nations of the EU are also buying their brain out in China, running up a trade deficit of around $200 billion a year (!56 billion Euros in 2010, Source).

No wonder Vladimir Putin has announced the decline of the West.

US GDP per capita is $48,000 per year. Applying that figure to the EU also, the half-trillion-dollar annual US/EU trade deficit with China represents the loss of over six million jobs, assuming that the imported goods could be produced at home for the same price that they are sold for in China.

But firms such as Dell, Microsoft, Hewlett Packard, Apple, Walmart go to the trouble of outsourcing to China, Brazil, Indonesia and Bangladesh only because it greatly lowers their cost.

How much it lowers their costs overall is hard to estimate. But according to the Wall Street Journal, a pair of American-made jeans that retail for $300 would retail for only $40 if made in China.

So the Western trade deficit with the the Third World displaces a disproportionate amount of local output. And whether the overall displacement ratio is two, three, six or eight, it is certain that cheap imports from the China and the rest of the Third World explain why, despite mass legal and illegal immigration plus natural population increase, the US has seen no gains in employment throughout the entire Obama presidency.

Likewise, the trade deficit with the Third World must explain much of the economic stress in Greece, Italy, Spain and Portugal, as well as the resumption of recession in Britain, a nation once the Workshop of the World, but now able to export little other than financial derivatives, marmalade and biscuits.

Friday, June 29, 2012

The Cause and Cure of the Second Great Depression

Image source
The Second Great Depression, which afflicts the West while the Rest booms, is the direct result of the 1994 General Agreement on Tariffs and Trade (Gatt) now administered by the World Trade Organization (WTO). The Gatt agreement opened the Western economies to free trade with four billion Third Worlders working for pennies an hour.

The immediate impact was slight. It takes a while to mobilized tens and hundreds of millions of the children of peasant farmers to work in the sweatshops, factories and plantations of of BanglaDesh, Indonesia, China and Africa. And as the process got underway, the US tech sector boomed, the stock market zoomed, banking was deregulated, the profits of finance exploded, and Bill Clinton was easily reelected US President in 1996.

But by 2000, the steam was going out of US high-tech. Software developers were learning how to exploit cheap Asian brain-power and Chinese universities were turning out more engineers and programmers than all the universities in the West combined. Tens and then hundreds of thousands of IT jobs moved to India, along with MicroSoft's call center. In the Philippines, University accounting courses taught American accounting rules to students preparing to do off-shored back-office work for US financial and accounting firms.

The result? Al Gore lost the US Presidential election to "compassionate conservative" George W. Bush.

In response to the tech-sector bust, The Greenspan Fed slashed interest rates and set off a real estate boom. Construction is labor intensive, and it stimulates local industries: lumber, cement and steel, so that by 2004 the US economy was good enough to get "humble foreign policy" George W. Bush reelected, notwithstanding that he had launched the US on the NeoCon war for global hegemony. In fact, the war for global hegemony was one reason the US economy was as good as it was in 2004. Spending on weapons and pre-emptive war in Iraq was a key factor preventing the US from falling into recession despite the massive bleeding of manufacturing, design, engineering and research jobs overseas.

Within a year of Bush's reelection, the Greenspan Fed pricked the property bubble with 17 consecutive interest rate increases. The housing crash and the consequent financial crisis ended the Republican hold on the White House.

But nothing much went right for Democrat President Obama. GM and Chrysler went broke. Most of the banks went broke. Dell computer gave up snapping Asian-sourced components together in Texas, instead bringing fully assembled boxes from China. Brutal violence continued in Iraq. The struggle to subdue Afghanistan seemed endless. And today, as the presidential election approaches, US Unemployment remains over 9% according to the headline rate, or 16% according the the U6 definition, and even higher if you take account of those who just gave up looking for work. And an unprecedented number of Americans are on food stamps or some other form of welfare.

Nobel Peace Prize winner, Obama, has done what he could within the limits of the clearly inadequate advice he received.  With the aid of "we have a technology called the printing press" Ben at the Fed, he's printed trillions of dollars, he's expanded the wars to Libya, Syria, Yemen and Pakistan. But the dark shadow of depression still falls across the land: meaning that Republican Romney's up next.

What will President Romney do? Pursue the wars, surely, and, as a buyout specialist, restructure the US economy. But can a Romney administration revive the US economy where the Obama administration failed? Sure, although whether it will do so is another matter.

What to do?

The terms recession and depression are ill-defined, but it is impossible to end either a persistent recession or a great depression without ending mass unemployment. So to end America's economic malaise, the US must instigate policies that lead to the creation of tens of millions of new jobs within four years. These jobs will be mainly for the low-skilled factory operatives and construction workers who've lost their jobs to off-shoring and outsourcing or to the housing bust.

How to do it according to the pundits?

In the public realm, only two approaches are commonly promoted: those of the Keynesian and of the Austrian Economics school.

The Keynesian solution:
According to the Keynesians, more spending is all that is required. Since the private sector won't spend enough, the government must spend more. This Obama has done. The Obama administration has run a budget deficit of more than $5 trillion over four years, yet US unemployment is higher now than when Obama was elected.

To the Keynesians, the failure of the Obama administration to end the depression has been due to the failure to run large enough deficits. Maybe if the deficit had run at 16% of GDP instead of only 8%, or perhaps 24%, then all would have been well.

But there are two problems with this:

First, the debts created by the deficit have to be repaid.

Second, little if any of the deficit spending does anything to increase national output of useful goods and services that generate income that will ease the eventual repayment of debt. Mostly, the money's gone on such things as the wars, Homeland Security and its blue-gloved goons feeling up airline passengers thus destroying a huge chunk of the US tourism industry, and shoving politically correct propaganda down kids' throats in the name of education.

 The Austrian dream:
The Austrians are too nutty to take very seriously, but their dream is to return to a gold-based currency, end the money-printing Fed, without which they believe, incorrectly, that government deficit spending would be impossible, and let all those who borrowed too much go broke. Then the Austrian school fanatics, with their hoards of "physical gold," will be able to buy up prime down-town real estate, the stock market, whatever, for pennies on the dollar.

Oh, and then the economy will recover -- somehow.

What would actually work

You cannot, as the Keynesians believe, pay wages for unproductive work with printed money indefinitely. Debts increase but real income to support the debt does not, so prosperity is ultimately destroyed. And you cannot, as the Austrians believe, revive the economy by sending much of it into bankruptcy.

Which means finding ways of employing idle resources, both human and physical, in ways that generate a positive net return.

Which means promoting new, productive investment at home, not abroad.

What are the greatest restraints in the West to investment at home? There are three:

First, is the corporation tax, which should be abolished. Corporate income should be taxed only once, and that should be when received in the hands of shareholders as dividend payments.

Second, is the minimum wage, which denies employment to those whose labor is worth less than the minimum wage, i.e., most of America's black youth, half of the youth workers in Spain, etc.

Third, is the freedom to import goods and services produced under conditions, or in ways, that contravene Western standards on environmental protection and workplace health and safety.

Putting the solution into place

Eliminating the corporation tax:
Eliminating the corporation tax is easy. Just do it. The immediate result will be a reduction in government revenue and an increase in the government deficit, but in time there will be a compensating increase in income and sales tax revenue from the resultant increase in investment and the consequent expansion of the economy.

Eliminating the minimum wage:
Eliminating the minimum wage is a little more complicated. The solution, as I have discussed elsewhere is a wage subsidy scheme that, in effect, eliminates the minimum wage so far as employers are concerned, but not for employees, who will therefore receive a living wage.

Such a scheme will make redundant most welfare programs and the bureaucratic empires that administer them, resulting in a massive saving in government spending. Among other savings will be huge reductions in the cost of crime and mental illness to which mass unemployment gives rise.

Most importantly, though, this scheme creates a huge addition to the labor force in the West that is competitive in cost with the labor force of the Third World. This new resource will result in a wave of business start-ups, both large and small. Once again Western firms will be able to make shoes and shirts, computers and car parts in competition with overseas producers. At the same time, those formerly unemployed will gain workplace skills that increase the market value of their labor, and thus their future income. 

Creating a level international playing field:
Eliminating the regulatory disadvantage of home industry will require a blunt instrument. Each nation or trade zone must calculate the cost to its own industry of unfair competition due to overseas workplace and environmental regulation and then impose an across the board tariff to compensate. Such a measure will do a great favor to workers in the Third World, where governments will be forced to adopt Western standards of environmental protection and workers' rights.

With these three measures, Western prosperity will be rapidly restored, and the need for the ultimate Keynesian economic stimulus, World War III, will be eliminated. Unfortunately, the leadership of US/NATO seems unanimous in support for the NeoCon war for global hegemony. So whether the Second Great Depression is ended in one way or another, we'll likely all end either broke, due to endless "stimulative" and totally unproductive war spending,  or dead.

Related:

Rolling Stone Magazine: The Sharp, Sudden Decline of America's Middle Class